ID: 978926510

View in Genome Browser
Species Human (GRCh38)
Location 4:114252073-114252095
Sequence ATGTCAAGGGTTAGATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978926510_978926522 28 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926510_978926516 -4 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926516 4:114252092-114252114 ACATGGACTGCCCTGAAGGGAGG No data
978926510_978926521 27 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926521 4:114252123-114252145 CAGCTCACCAAAGCCCCCCTTGG 0: 3
1: 4
2: 10
3: 27
4: 208
978926510_978926514 -8 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926514 4:114252088-114252110 CTTGACATGGACTGCCCTGAAGG No data
978926510_978926518 0 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926518 4:114252096-114252118 GGACTGCCCTGAAGGGAGGAGGG No data
978926510_978926515 -7 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926515 4:114252089-114252111 TTGACATGGACTGCCCTGAAGGG No data
978926510_978926517 -1 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926517 4:114252095-114252117 TGGACTGCCCTGAAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978926510 Original CRISPR ATGTCAAGGGTTAGATCTTC AGG (reversed) Intergenic
No off target data available for this crispr