ID: 978926513

View in Genome Browser
Species Human (GRCh38)
Location 4:114252087-114252109
Sequence CTTCAGGGCAGTCCATGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978926513_978926532 30 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926532 4:114252140-114252162 CCTTGGGACAAGGGGAGATGTGG No data
978926513_978926526 22 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926526 4:114252132-114252154 AAAGCCCCCCTTGGGACAAGGGG No data
978926513_978926524 20 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926524 4:114252130-114252152 CCAAAGCCCCCCTTGGGACAAGG No data
978926513_978926521 13 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926521 4:114252123-114252145 CAGCTCACCAAAGCCCCCCTTGG 0: 3
1: 4
2: 10
3: 27
4: 208
978926513_978926522 14 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926513_978926525 21 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926525 4:114252131-114252153 CAAAGCCCCCCTTGGGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978926513 Original CRISPR CTTCAGGGCAGTCCATGTCA AGG (reversed) Intergenic
No off target data available for this crispr