ID: 978926519

View in Genome Browser
Species Human (GRCh38)
Location 4:114252102-114252124
Sequence TGTGTTCCCTCCTCCCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978926519_978926532 15 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926532 4:114252140-114252162 CCTTGGGACAAGGGGAGATGTGG No data
978926519_978926533 24 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926533 4:114252149-114252171 AAGGGGAGATGTGGACACAGTGG No data
978926519_978926524 5 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926524 4:114252130-114252152 CCAAAGCCCCCCTTGGGACAAGG No data
978926519_978926526 7 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926526 4:114252132-114252154 AAAGCCCCCCTTGGGACAAGGGG No data
978926519_978926522 -1 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926519_978926525 6 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926525 4:114252131-114252153 CAAAGCCCCCCTTGGGACAAGGG No data
978926519_978926521 -2 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926521 4:114252123-114252145 CAGCTCACCAAAGCCCCCCTTGG 0: 3
1: 4
2: 10
3: 27
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978926519 Original CRISPR TGTGTTCCCTCCTCCCTTCA GGG (reversed) Intergenic
No off target data available for this crispr