ID: 978926522

View in Genome Browser
Species Human (GRCh38)
Location 4:114252124-114252146
Sequence AGCTCACCAAAGCCCCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978926519_978926522 -1 Left 978926519 4:114252102-114252124 CCCTGAAGGGAGGAGGGAACACA No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926520_978926522 -2 Left 978926520 4:114252103-114252125 CCTGAAGGGAGGAGGGAACACAG No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926512_978926522 15 Left 978926512 4:114252086-114252108 CCCTTGACATGGACTGCCCTGAA No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926510_978926522 28 Left 978926510 4:114252073-114252095 CCTGAAGATCTAACCCTTGACAT No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data
978926513_978926522 14 Left 978926513 4:114252087-114252109 CCTTGACATGGACTGCCCTGAAG No data
Right 978926522 4:114252124-114252146 AGCTCACCAAAGCCCCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978926522 Original CRISPR AGCTCACCAAAGCCCCCCTT GGG Intergenic
No off target data available for this crispr