ID: 978933270

View in Genome Browser
Species Human (GRCh38)
Location 4:114343815-114343837
Sequence CTCAATACTAATTTGGGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978933261_978933270 30 Left 978933261 4:114343762-114343784 CCCAGAAATTTACCTTTTTATAT No data
Right 978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG No data
978933262_978933270 29 Left 978933262 4:114343763-114343785 CCAGAAATTTACCTTTTTATATT No data
Right 978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG No data
978933265_978933270 -7 Left 978933265 4:114343799-114343821 CCCTTGCCATACTTTTCTCAATA No data
Right 978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG No data
978933266_978933270 -8 Left 978933266 4:114343800-114343822 CCTTGCCATACTTTTCTCAATAC No data
Right 978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG No data
978933264_978933270 3 Left 978933264 4:114343789-114343811 CCTTGTTTTTCCCTTGCCATACT No data
Right 978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG No data
978933263_978933270 18 Left 978933263 4:114343774-114343796 CCTTTTTATATTTATCCTTGTTT No data
Right 978933270 4:114343815-114343837 CTCAATACTAATTTGGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978933270 Original CRISPR CTCAATACTAATTTGGGTTA TGG Intergenic
No off target data available for this crispr