ID: 978934726

View in Genome Browser
Species Human (GRCh38)
Location 4:114360283-114360305
Sequence AGGGAGAGCACAGAGACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978934726_978934735 30 Left 978934726 4:114360283-114360305 CCGGCAGTCTCTGTGCTCTCCCT No data
Right 978934735 4:114360336-114360358 CATGTGGCAATGCTAGGGAATGG No data
978934726_978934733 24 Left 978934726 4:114360283-114360305 CCGGCAGTCTCTGTGCTCTCCCT No data
Right 978934733 4:114360330-114360352 CCATGTCATGTGGCAATGCTAGG No data
978934726_978934734 25 Left 978934726 4:114360283-114360305 CCGGCAGTCTCTGTGCTCTCCCT No data
Right 978934734 4:114360331-114360353 CATGTCATGTGGCAATGCTAGGG No data
978934726_978934731 14 Left 978934726 4:114360283-114360305 CCGGCAGTCTCTGTGCTCTCCCT No data
Right 978934731 4:114360320-114360342 GATTTTTTCTCCATGTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978934726 Original CRISPR AGGGAGAGCACAGAGACTGC CGG (reversed) Intergenic
No off target data available for this crispr