ID: 978935430

View in Genome Browser
Species Human (GRCh38)
Location 4:114369086-114369108
Sequence GGTGGGCCACCATACATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978935430_978935436 15 Left 978935430 4:114369086-114369108 CCCTTAATGTATGGTGGCCCACC No data
Right 978935436 4:114369124-114369146 TTTATTACTACAATTTTCTTGGG No data
978935430_978935435 14 Left 978935430 4:114369086-114369108 CCCTTAATGTATGGTGGCCCACC No data
Right 978935435 4:114369123-114369145 ATTTATTACTACAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978935430 Original CRISPR GGTGGGCCACCATACATTAA GGG (reversed) Intergenic
No off target data available for this crispr