ID: 978936955

View in Genome Browser
Species Human (GRCh38)
Location 4:114389281-114389303
Sequence AGGTAGCTCAAAGAACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978936946_978936955 20 Left 978936946 4:114389238-114389260 CCAGCGCAAGCTGAGGTCTGAGG No data
Right 978936955 4:114389281-114389303 AGGTAGCTCAAAGAACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978936955 Original CRISPR AGGTAGCTCAAAGAACACCT GGG Intergenic