ID: 978938429

View in Genome Browser
Species Human (GRCh38)
Location 4:114408274-114408296
Sequence CCAGGTGAGCAGTTATTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978938426_978938429 9 Left 978938426 4:114408242-114408264 CCATTAAAGGAAAACTTATAGTA No data
Right 978938429 4:114408274-114408296 CCAGGTGAGCAGTTATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978938429 Original CRISPR CCAGGTGAGCAGTTATTATC TGG Intergenic
No off target data available for this crispr