ID: 978940900

View in Genome Browser
Species Human (GRCh38)
Location 4:114434954-114434976
Sequence CTGGCAAAGCAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978940895_978940900 18 Left 978940895 4:114434913-114434935 CCATTGGAACACGAATGGGGGTA No data
Right 978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978940900 Original CRISPR CTGGCAAAGCAGAGTGAGGA AGG Intergenic
No off target data available for this crispr