ID: 978941155 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:114437276-114437298 |
Sequence | TGACAAAAACAGAGGAAGGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
978941149_978941155 | 26 | Left | 978941149 | 4:114437227-114437249 | CCTATAAGAGGGAGAGAGTAGAA | No data | ||
Right | 978941155 | 4:114437276-114437298 | TGACAAAAACAGAGGAAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
978941155 | Original CRISPR | TGACAAAAACAGAGGAAGGT TGG | Intergenic | ||
No off target data available for this crispr |