ID: 978941155

View in Genome Browser
Species Human (GRCh38)
Location 4:114437276-114437298
Sequence TGACAAAAACAGAGGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978941149_978941155 26 Left 978941149 4:114437227-114437249 CCTATAAGAGGGAGAGAGTAGAA No data
Right 978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978941155 Original CRISPR TGACAAAAACAGAGGAAGGT TGG Intergenic
No off target data available for this crispr