ID: 978947961

View in Genome Browser
Species Human (GRCh38)
Location 4:114521768-114521790
Sequence ACTGCTATCCAGGATCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978947961_978947966 24 Left 978947961 4:114521768-114521790 CCTCATAGATCCTGGATAGCAGT No data
Right 978947966 4:114521815-114521837 AATATTTTCTCCCACTCTGTGGG 0: 235
1: 3706
2: 14984
3: 17298
4: 9215
978947961_978947965 23 Left 978947961 4:114521768-114521790 CCTCATAGATCCTGGATAGCAGT No data
Right 978947965 4:114521814-114521836 AAATATTTTCTCCCACTCTGTGG 0: 125
1: 1759
2: 3847
3: 4310
4: 4022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978947961 Original CRISPR ACTGCTATCCAGGATCTATG AGG (reversed) Intergenic
No off target data available for this crispr