ID: 978947965

View in Genome Browser
Species Human (GRCh38)
Location 4:114521814-114521836
Sequence AAATATTTTCTCCCACTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14063
Summary {0: 125, 1: 1759, 2: 3847, 3: 4310, 4: 4022}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978947961_978947965 23 Left 978947961 4:114521768-114521790 CCTCATAGATCCTGGATAGCAGT No data
Right 978947965 4:114521814-114521836 AAATATTTTCTCCCACTCTGTGG 0: 125
1: 1759
2: 3847
3: 4310
4: 4022
978947963_978947965 13 Left 978947963 4:114521778-114521800 CCTGGATAGCAGTCTTTTGGTGG No data
Right 978947965 4:114521814-114521836 AAATATTTTCTCCCACTCTGTGG 0: 125
1: 1759
2: 3847
3: 4310
4: 4022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978947965 Original CRISPR AAATATTTTCTCCCACTCTG TGG Intergenic
Too many off-targets to display for this crispr