ID: 978947966

View in Genome Browser
Species Human (GRCh38)
Location 4:114521815-114521837
Sequence AATATTTTCTCCCACTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45438
Summary {0: 235, 1: 3706, 2: 14984, 3: 17298, 4: 9215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978947961_978947966 24 Left 978947961 4:114521768-114521790 CCTCATAGATCCTGGATAGCAGT No data
Right 978947966 4:114521815-114521837 AATATTTTCTCCCACTCTGTGGG 0: 235
1: 3706
2: 14984
3: 17298
4: 9215
978947963_978947966 14 Left 978947963 4:114521778-114521800 CCTGGATAGCAGTCTTTTGGTGG No data
Right 978947966 4:114521815-114521837 AATATTTTCTCCCACTCTGTGGG 0: 235
1: 3706
2: 14984
3: 17298
4: 9215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978947966 Original CRISPR AATATTTTCTCCCACTCTGT GGG Intergenic
Too many off-targets to display for this crispr