ID: 978948734

View in Genome Browser
Species Human (GRCh38)
Location 4:114530032-114530054
Sequence CCATATCACTATCAGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6052
Summary {0: 923, 1: 1673, 2: 1637, 3: 1068, 4: 751}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978948734_978948739 11 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948739 4:114530066-114530088 CAGGCTGAAGTGGTCTCAGATGG 0: 118
1: 1682
2: 2106
3: 1476
4: 1055
978948734_978948737 1 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948737 4:114530056-114530078 CAATAAAGTCCAGGCTGAAGTGG No data
978948734_978948742 30 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG No data
978948734_978948740 26 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948740 4:114530081-114530103 TCAGATGGAGATGAAGAATTAGG No data
978948734_978948736 -8 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948736 4:114530047-114530069 TGATATGGACAATAAAGTCCAGG 0: 250
1: 1084
2: 1948
3: 1755
4: 1236
978948734_978948741 29 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948741 4:114530084-114530106 GATGGAGATGAAGAATTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978948734 Original CRISPR CCATATCACTATCAGCATTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr