ID: 978948738

View in Genome Browser
Species Human (GRCh38)
Location 4:114530065-114530087
Sequence CATCTGAGACCACTTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6570
Summary {0: 109, 1: 1645, 2: 2095, 3: 1524, 4: 1197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978948738_978948743 11 Left 978948738 4:114530065-114530087 CCAGGCTGAAGTGGTCTCAGATG 0: 109
1: 1645
2: 2095
3: 1524
4: 1197
Right 978948743 4:114530099-114530121 TTAGGTGGGAACTGAAGTAAAGG No data
978948738_978948741 -4 Left 978948738 4:114530065-114530087 CCAGGCTGAAGTGGTCTCAGATG 0: 109
1: 1645
2: 2095
3: 1524
4: 1197
Right 978948741 4:114530084-114530106 GATGGAGATGAAGAATTAGGTGG No data
978948738_978948740 -7 Left 978948738 4:114530065-114530087 CCAGGCTGAAGTGGTCTCAGATG 0: 109
1: 1645
2: 2095
3: 1524
4: 1197
Right 978948740 4:114530081-114530103 TCAGATGGAGATGAAGAATTAGG No data
978948738_978948742 -3 Left 978948738 4:114530065-114530087 CCAGGCTGAAGTGGTCTCAGATG 0: 109
1: 1645
2: 2095
3: 1524
4: 1197
Right 978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978948738 Original CRISPR CATCTGAGACCACTTCAGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr