ID: 978948742

View in Genome Browser
Species Human (GRCh38)
Location 4:114530085-114530107
Sequence ATGGAGATGAAGAATTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978948734_978948742 30 Left 978948734 4:114530032-114530054 CCAAAATGCTGATAGTGATATGG 0: 923
1: 1673
2: 1637
3: 1068
4: 751
Right 978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG No data
978948738_978948742 -3 Left 978948738 4:114530065-114530087 CCAGGCTGAAGTGGTCTCAGATG 0: 109
1: 1645
2: 2095
3: 1524
4: 1197
Right 978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978948742 Original CRISPR ATGGAGATGAAGAATTAGGT GGG Intergenic
No off target data available for this crispr