ID: 978948785

View in Genome Browser
Species Human (GRCh38)
Location 4:114530775-114530797
Sequence GAGAATTAATAAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978948782_978948785 9 Left 978948782 4:114530743-114530765 CCACTTTCAACAGTTGACATAAT No data
Right 978948785 4:114530775-114530797 GAGAATTAATAAGGAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978948785 Original CRISPR GAGAATTAATAAGGAAACAC TGG Intergenic
No off target data available for this crispr