ID: 978949839

View in Genome Browser
Species Human (GRCh38)
Location 4:114544892-114544914
Sequence CCACTACAATACAAAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978949833_978949839 15 Left 978949833 4:114544854-114544876 CCTGAATCAGCTAAACCACTAAA No data
Right 978949839 4:114544892-114544914 CCACTACAATACAAAGAATGAGG No data
978949832_978949839 16 Left 978949832 4:114544853-114544875 CCCTGAATCAGCTAAACCACTAA No data
Right 978949839 4:114544892-114544914 CCACTACAATACAAAGAATGAGG No data
978949835_978949839 0 Left 978949835 4:114544869-114544891 CCACTAAACCATAGGAAAGTAAC No data
Right 978949839 4:114544892-114544914 CCACTACAATACAAAGAATGAGG No data
978949836_978949839 -8 Left 978949836 4:114544877-114544899 CCATAGGAAAGTAACCCACTACA No data
Right 978949839 4:114544892-114544914 CCACTACAATACAAAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978949839 Original CRISPR CCACTACAATACAAAGAATG AGG Intergenic
No off target data available for this crispr