ID: 978957788

View in Genome Browser
Species Human (GRCh38)
Location 4:114635683-114635705
Sequence AATGGATCTTTTTTATGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978957788_978957793 30 Left 978957788 4:114635683-114635705 CCCCCTCATAAAAAAGATCCATT 0: 1
1: 0
2: 1
3: 20
4: 334
Right 978957793 4:114635736-114635758 TGTAAATAAAACTTCAAATGAGG 0: 1
1: 0
2: 6
3: 52
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978957788 Original CRISPR AATGGATCTTTTTTATGAGG GGG (reversed) Intronic
900076976 1:825819-825841 AAGGTATCTTTCTAATGAGGAGG - Intergenic
900824355 1:4914098-4914120 AATGTATCTTTTTTTTGGGGGGG + Intergenic
903511875 1:23881924-23881946 TATGGATCTTTTTCTTGAGATGG + Intronic
903532726 1:24044236-24044258 AAAGAATTTTTTTTTTGAGGTGG + Intergenic
903578967 1:24357051-24357073 CATGGATTTTTTTTTTGGGGGGG - Exonic
903591384 1:24458549-24458571 AATGGCTCTTTTTAGTGGGGTGG + Intronic
904075069 1:27835011-27835033 AATGAATTTTTTTTTTGAGATGG - Intronic
904197705 1:28798174-28798196 AATTGAACTTTTTTTTGAGACGG + Intergenic
904730391 1:32586313-32586335 AATAGTTCTTTTTTTTGAGACGG - Intronic
905044729 1:34986704-34986726 GATAGATCTTTTTTTTGAGATGG - Intronic
905486990 1:38307150-38307172 AGTGGATCTTTTCGTTGAGGTGG + Intergenic
906794891 1:48689009-48689031 AATGGATCTTCTTTCTGAATGGG - Intronic
907195345 1:52681945-52681967 ACTGGATTTTTTTTTTGAGATGG - Intergenic
908994786 1:70138339-70138361 AACTGATCTTTTTTAAAAGGTGG - Intronic
909215199 1:72878021-72878043 GATGGATGTATTTTATTAGGTGG + Intergenic
909812351 1:79946080-79946102 AATTGGTCCTCTTTATGAGGAGG - Intergenic
909962778 1:81868015-81868037 AGTGGAGCTTTTTTATTAAGTGG - Intronic
911115823 1:94246524-94246546 GATGGATCTTTTTTGGGCGGGGG - Intronic
912994474 1:114519405-114519427 AATGATTCTTTTTTTTGAGATGG + Intergenic
913333995 1:117691719-117691741 AATGGGTCATTTTATTGAGGTGG - Intergenic
914710247 1:150206572-150206594 ACTGGATTTTTTTTATAGGGAGG - Intergenic
914782154 1:150795174-150795196 AATTAATTTTTTATATGAGGTGG + Intergenic
916226260 1:162492688-162492710 AATGGATATTTTTCACAAGGAGG + Intergenic
917644009 1:177011821-177011843 AATTGATTTTTTTTTTGAGGTGG - Intronic
919109239 1:193197078-193197100 TATGTATCTTTATTATGTGGAGG + Intronic
919368000 1:196689752-196689774 AATAGATCTTTTCTATTATGAGG + Intronic
919374667 1:196779492-196779514 AATAGATCTTTTCTATTATGAGG + Intronic
920336143 1:205246755-205246777 TATGCAGCTATTTTATGAGGAGG + Intronic
920791894 1:209100917-209100939 AATGGATGCTTTTTAAGATGTGG - Intergenic
920887646 1:209947064-209947086 AAGGCATCTTTTTTCTGAGTAGG - Intronic
921856604 1:219992912-219992934 AATGAATTTTTTTTTTGAGACGG - Intronic
921947666 1:220897194-220897216 AATGCATTTTTTTTTTGAGAGGG - Intergenic
921997195 1:221433588-221433610 AATGTATCTATTATATGAAGAGG - Intergenic
922188824 1:223299199-223299221 AATGGATATGTTATTTGAGGGGG - Intronic
922318590 1:224464299-224464321 AATTGATTTTTTTTTTGAGATGG + Intronic
923519877 1:234727085-234727107 AATTGAGTTTTTTAATGAGGGGG - Intergenic
923931044 1:238697376-238697398 AATGGATCTTTTTTGTCAAAAGG - Intergenic
924405298 1:243738392-243738414 AATGCATCTTATTTCTTAGGAGG + Intronic
1063642243 10:7841521-7841543 AATGGATATTTTTTAAGTAGGGG + Intronic
1063892471 10:10644671-10644693 CATGGATCTCTTTTCTGACGTGG + Intergenic
1064283053 10:13968834-13968856 AACAGATTTTTTTTTTGAGGGGG + Intronic
1064628900 10:17289206-17289228 CCTGGATCTCTTTTATGAAGTGG - Intergenic
1064687554 10:17879356-17879378 AACTATTCTTTTTTATGAGGTGG + Intronic
1065613723 10:27499434-27499456 AGTGAAACTTTTTTAAGAGGCGG - Intergenic
1066243955 10:33563827-33563849 ACCTGATCTTTTTTATGAGCTGG - Intergenic
1067083173 10:43223364-43223386 TAGGGATTTTTTTTATGAAGTGG - Intronic
1067397757 10:45938339-45938361 ATTGGTCCTTTTATATGAGGGGG - Intergenic
1067866078 10:49907433-49907455 ATTGGTCCTTTTATATGAGGGGG - Intronic
1067902135 10:50253127-50253149 CATGGCTCCTTTTTATGATGGGG - Intergenic
1070162744 10:73875503-73875525 ACTGAATCTTTTTTTTGAGACGG + Intergenic
1070266298 10:74906389-74906411 AAAAGATTTTTTTTTTGAGGTGG - Intronic
1071271191 10:84009209-84009231 AGTGGAACATTTTTATGAGTTGG - Intergenic
1071852465 10:89588188-89588210 AATGGATTTTTTTTTTAATGTGG - Intronic
1072030520 10:91517205-91517227 AATAGATGTTCTTTATGAGGAGG - Intergenic
1072926800 10:99622927-99622949 CATGGAGCTTTTTAATGATGAGG + Intergenic
1075491399 10:122873427-122873449 AAAGGAACTTTTTTCTGAGCAGG - Intronic
1076766477 10:132637221-132637243 AATTGATCTTTTTTACCTGGAGG + Intronic
1079897076 11:26133746-26133768 AATGTATCTTTTTTATGACATGG - Intergenic
1081227590 11:40543456-40543478 CATGGCTCTGTTTTGTGAGGAGG - Intronic
1081341612 11:41934858-41934880 AATGGATCTTGTTTATGTGAGGG + Intergenic
1083979005 11:66149751-66149773 AACTGATCTTTTTTTTGAGACGG + Intronic
1084266132 11:68006154-68006176 AAAGGATTTTTTTTTTTAGGTGG + Intergenic
1085778746 11:79389731-79389753 AATGGAACTTCTTTTTGTGGGGG - Intronic
1087960575 11:104343454-104343476 AATGTCTCTATTTTATGATGTGG + Intergenic
1088535081 11:110851806-110851828 AATGCATTTTTTTTTTGAGATGG - Intergenic
1088685423 11:112280824-112280846 AGTGGATCTTTTTGAGGTGGGGG - Intergenic
1089222410 11:116884866-116884888 AATGCTTATTTTTTATGAGTCGG - Intronic
1090745914 11:129704709-129704731 ACTGGATTTTTTTTATGGGTTGG - Intergenic
1090999160 11:131893917-131893939 CATGTTTCTTTTTGATGAGGAGG + Intronic
1091245090 11:134086292-134086314 AAGGGAGCTTTTTTAAGAGAAGG - Intronic
1091337561 11:134783892-134783914 TATTGATCTTAATTATGAGGAGG + Intergenic
1091717243 12:2787352-2787374 AATGGATGTTTCTCATGAGGTGG - Intergenic
1092697217 12:11186155-11186177 ATTGGATATTTTTTATGTTGTGG - Exonic
1092978881 12:13773529-13773551 AATGCCTCTTTTTTCTCAGGAGG + Intronic
1093084192 12:14848400-14848422 AATATATCTTTTTTTTGGGGGGG + Intronic
1093429313 12:19066021-19066043 AATAGGCCTTTTCTATGAGGAGG + Intergenic
1093780540 12:23131936-23131958 GATGGTTCTTTTTACTGAGGAGG - Intergenic
1094671392 12:32573097-32573119 ATTGGATTTTTTTTTTGAGACGG + Intronic
1097988002 12:65804494-65804516 AATGGATTTTTTTTTTGAGGTGG - Intergenic
1099136299 12:78907290-78907312 AATGAATCTATTTTATGGGGTGG - Intronic
1099165045 12:79295021-79295043 TATGCATTTTTTTTAAGAGGGGG + Intronic
1100711369 12:97260596-97260618 AATTGATCTTTTCTATGAGTAGG + Intergenic
1101648658 12:106654803-106654825 ATTGCATTTTTTTTATAAGGTGG - Intronic
1101688717 12:107053318-107053340 AATGTATTTTTTTTTTGAGACGG + Intronic
1102186671 12:110953754-110953776 AGGGGATCTTTGTTATGTGGTGG - Intergenic
1103062709 12:117871825-117871847 TATGGATTTTTTTTAAGAGAGGG + Intronic
1105285383 13:18999138-18999160 AATGGATATTTGTTAAAAGGAGG - Intergenic
1107141791 13:37006201-37006223 AAGGGATTTTTTTTTTGTGGGGG + Intronic
1107276454 13:38685988-38686010 AAGGGATCTTTTTTGAGGGGGGG + Intergenic
1108780694 13:53827685-53827707 TCTGGAACTTTTTTATGATGAGG + Intergenic
1111556402 13:89887063-89887085 AATGTGTCTTTTTTTTGAGACGG + Intergenic
1112097627 13:96152022-96152044 AATGTATCTTTTTTGGGTGGGGG + Intronic
1113122881 13:106943219-106943241 ATTGGTTCTCTTTTATGAGGTGG + Intergenic
1113282691 13:108807442-108807464 AATAGATCTTTTTTTACAGGAGG - Intronic
1114880807 14:26783620-26783642 AATGGATCTATTTTGTGCAGAGG + Intergenic
1115605114 14:34993374-34993396 CCTGGATCTTTTCCATGAGGTGG + Intronic
1116223632 14:42119397-42119419 ACTGTAGCTTTTTTATGGGGGGG - Intergenic
1116365723 14:44060523-44060545 AATGGATGATTTTTGTGGGGAGG - Intergenic
1116578580 14:46608034-46608056 ACTCTATCTTTTTTATGAGCAGG - Intergenic
1117290678 14:54329465-54329487 ATTTGACCTTTTTTATGCGGAGG + Intergenic
1117388743 14:55243101-55243123 AAATGAACTTTTTTCTGAGGTGG - Intergenic
1120351299 14:83362420-83362442 TAAGGATCTTTTTTAGGGGGAGG + Intergenic
1120690528 14:87587913-87587935 AATGGATCATTTTTCAGAGCTGG + Intergenic
1121391581 14:93580708-93580730 AATGTATTTTTTTTTTGAGACGG + Intronic
1121859040 14:97299222-97299244 TATTGAGCTTTTTTAAGAGGAGG + Intergenic
1123628275 15:22242770-22242792 AATGGATTTTTTTTTTGAGATGG + Intergenic
1123896565 15:24836413-24836435 AATGCATTTTTTTTTTGAGACGG + Intronic
1125363362 15:38888051-38888073 AATTTATATTTTTTATGAGGAGG - Intergenic
1125479883 15:40072727-40072749 AATGGACCTTTTGGGTGAGGGGG - Intergenic
1126468680 15:48983963-48983985 AATAGTTCTTTTTTGTGGGGTGG + Intergenic
1127323578 15:57871923-57871945 AATGAATGTTCTTTATTAGGCGG + Intergenic
1128034814 15:64515546-64515568 AATGGATCTTCTTTTTAAAGGGG + Intronic
1130171642 15:81520679-81520701 AATGCATCTCTTTTCTAAGGAGG - Intergenic
1131133995 15:89919169-89919191 TATATATCTTTTTTTTGAGGTGG - Intergenic
1132825311 16:1902027-1902049 AATTCATTTTTTTTTTGAGGCGG - Intergenic
1134321644 16:13169606-13169628 GATGTATCATTTTTAAGAGGAGG + Intronic
1137762540 16:50952271-50952293 AAGGCATCTTTTTTGTCAGGTGG + Intergenic
1139527246 16:67524630-67524652 AATGGTGTTTTTTAATGAGGTGG - Intronic
1140635435 16:76907734-76907756 AATGGAAGTTTTTTAAGTGGAGG - Intergenic
1141942424 16:87286233-87286255 AATAGATTTTTTTTTTGAGATGG - Intronic
1141975670 16:87514554-87514576 AATGGACTTTTTTTTTGAGATGG - Intergenic
1142987996 17:3708871-3708893 AAAGGTTTTTTTTTTTGAGGGGG - Intergenic
1145094567 17:20014759-20014781 AGTGGATTTTTTTTTTGAGATGG + Intronic
1148217519 17:45841145-45841167 AATGGGACTTTTTTTTGAGATGG - Intergenic
1149964083 17:61144204-61144226 CATGGATTTTTTTTTTAAGGAGG + Intronic
1150120229 17:62594964-62594986 AATTGATTTTTTTTTTGAGACGG + Intronic
1153049340 18:886370-886392 AATTGATCTTGATTATGAAGGGG + Intergenic
1153178832 18:2409715-2409737 AACGGTTCTTTTTTTTGAGATGG + Intergenic
1155601625 18:27555489-27555511 AATGGACATTTTACATGAGGGGG + Intergenic
1156300896 18:35835048-35835070 AATGTAACTTTTTTCTGTGGTGG - Intergenic
1156616864 18:38797110-38797132 AATGTATTTTTTTGATGAGAAGG + Intergenic
1157037920 18:43998878-43998900 AATAGATCCCTTTAATGAGGTGG - Intergenic
1158170186 18:54589308-54589330 AAAGGATCTTTGTTCTGAGCAGG - Intronic
1159654792 18:71020048-71020070 AATGGATATATTTTGTGAGATGG + Intergenic
1160096803 18:75880735-75880757 AATGGATTTTTTTTAAAAGTGGG - Intergenic
1160166013 18:76513069-76513091 AATGGTTTTTTTTTTTGAGACGG - Intergenic
1161717371 19:5884117-5884139 AATGCATTTTTTTTTTGAGACGG + Intronic
1162324417 19:9990565-9990587 AATTAATTTTTTTTTTGAGGTGG + Intronic
1163027434 19:14520436-14520458 TATGTAACTTTTTTATGGGGAGG - Intronic
1163919076 19:20271902-20271924 AATGGTTTTTTTTTTTGAGATGG + Intergenic
1163997007 19:21059784-21059806 CATGAGTCTTTTTTATTAGGTGG + Exonic
1164396891 19:27873433-27873455 CATGGATCTTATTTATAAAGGGG - Intergenic
1165185844 19:34020331-34020353 ACATGATCTTTTTTTTGAGGCGG - Intergenic
1165320636 19:35083203-35083225 AATTGATTTTTTTTTTGAGGGGG + Intergenic
1167177171 19:47873170-47873192 AATGGATTTTTGTTTTGAGCCGG + Intronic
1167539998 19:50079765-50079787 AATGGATTTTTTTTTTGAGATGG - Intergenic
926309280 2:11662774-11662796 AATGCATTTTTTTTTTGAGACGG - Intronic
927078358 2:19602840-19602862 AATGTATTTTTTTTTTGAGACGG - Intergenic
927225388 2:20760095-20760117 AAATTATCTTTTTTTTGAGGTGG + Intronic
930370587 2:50496168-50496190 AATGGAGATTTTTTTTCAGGTGG + Intronic
930884427 2:56308683-56308705 AATGGCATTTGTTTATGAGGAGG + Intronic
930891269 2:56390657-56390679 AATGGTTGTTTCATATGAGGTGG + Intergenic
931403704 2:61955687-61955709 AATTGATATTTTTTTTGAGATGG + Intronic
931547250 2:63402645-63402667 AATGGCTATTTTTTTTGAGACGG + Intronic
932224816 2:70031170-70031192 ACTGGTTTTTTTCTATGAGGAGG + Intergenic
935182476 2:100703235-100703257 AATGCATCATTTTTATGATTGGG - Intergenic
938295280 2:130174306-130174328 AAAGAATCTTTTTTTTGTGGTGG - Intronic
940952622 2:159693310-159693332 ACTGGTGCTTTTTTATGAGGTGG + Intergenic
942780863 2:179641076-179641098 AAAGAATCTTTTTTATGCAGTGG - Intronic
942826256 2:180180445-180180467 AATGAATTTTTTTTAGAAGGTGG - Intergenic
943333532 2:186588256-186588278 AATGCATTTTTTTTTTGAGATGG + Intergenic
943955084 2:194177443-194177465 AATAGATGTTTGTTATTAGGAGG + Intergenic
944153610 2:196588897-196588919 TATGTATCTTTTTTATAAGTAGG - Intronic
945005078 2:205396573-205396595 GATGGATCTTTTTTGTAAAGTGG - Intronic
946566717 2:220973341-220973363 AAAGGATGTTATTTATGAGATGG + Intergenic
946633038 2:221692388-221692410 GTTAGATCTTTTTTATGAGATGG - Intergenic
946823442 2:223653298-223653320 AGTGGAGCATTTTTATGTGGGGG - Intergenic
948300548 2:236903621-236903643 AAAGGATCCATTTGATGAGGGGG - Intergenic
948979951 2:241488939-241488961 AAAGAATCTTTTTTAAAAGGAGG - Intronic
1171543076 20:25979350-25979372 AATGGCTCCTTTGTATGGGGAGG - Intergenic
1171846124 20:30275994-30276016 AGTGGCTCCTTTTTATGAGGAGG - Intergenic
1172495144 20:35376301-35376323 TATTGATTTTTTTTTTGAGGCGG - Intronic
1173833232 20:46106754-46106776 AAAGGATTTTTTTTTTGAGATGG - Intergenic
1173885325 20:46452522-46452544 AATGGATCTTGTGTGTTAGGAGG + Intergenic
1174293057 20:49522496-49522518 AAAGGATTTTTTTTAAGAGGTGG + Intronic
1175189973 20:57204891-57204913 AATGCATCATTATTAAGAGGTGG + Intronic
1176692748 21:9936386-9936408 AATGCATTTTTTTTATGTAGTGG - Intergenic
1177964317 21:27708267-27708289 AATGGCTTTTTTTTATGTTGAGG + Intergenic
1178169246 21:30020330-30020352 TATGGATCTATTATGTGAGGTGG + Intergenic
1178213978 21:30572281-30572303 AATGTAACTTTTTGATGAGTTGG + Intergenic
1178234044 21:30821464-30821486 AAAGGATTTTATTTAGGAGGTGG - Intergenic
1178913794 21:36696091-36696113 AATGGAACATTTCTAAGAGGTGG + Intergenic
1180558640 22:16597958-16597980 TATGAATTTTTTTTTTGAGGCGG + Intergenic
1182581878 22:31318564-31318586 GATGGATTTTTTTTTTGAGACGG + Intergenic
1183541701 22:38432964-38432986 CATTGATCTTTTTTTTGAGATGG - Intronic
1183949619 22:41345579-41345601 AAGGGATTTTTTTTTTGAGATGG - Intronic
1184313939 22:43667620-43667642 AAAGGATATTTTTTGTGAAGTGG + Intronic
1184322220 22:43751190-43751212 AACGTATTTTTTTTGTGAGGGGG + Intronic
1184510105 22:44928412-44928434 AAAGGAACTTTTTTTTGAGACGG + Intronic
1184635795 22:45829484-45829506 AATGGTTTTTGTGTATGAGGGGG - Intronic
949580000 3:5378144-5378166 TGGGGATCTTTTGTATGAGGGGG + Intergenic
950008904 3:9708636-9708658 AAGGAATCTTTTTTTTGAGACGG + Intronic
950641279 3:14350149-14350171 AATGAATTTTTTTTTTGAGACGG + Intergenic
951876811 3:27435847-27435869 ATTGGATTTTTTTTTTAAGGGGG - Intronic
952757104 3:36880301-36880323 AATCGATGTTTCTCATGAGGTGG - Intronic
954264903 3:49464417-49464439 AATGTTTTTTTTTTTTGAGGCGG - Intergenic
957006759 3:74957672-74957694 GATGGATTTTTTTTTTGAGACGG + Intergenic
957688172 3:83531422-83531444 AATGGTTCCCTTTTGTGAGGAGG + Intergenic
958197342 3:90258032-90258054 AATTAATATTTTTTATGTGGTGG - Intergenic
958420787 3:93928165-93928187 AATTAATATTTTTTATGTGGTGG - Intronic
959414832 3:106071725-106071747 AATGTAGCTTTTTTACGACGTGG - Intergenic
959929050 3:111958848-111958870 AATGCATCTACTTTTTGAGGGGG - Intronic
960880840 3:122343070-122343092 ATTGGATCTTTTTTTTGGGATGG - Intergenic
961052484 3:123758685-123758707 AATAGATCTTTTTGATTAAGCGG - Intronic
962092236 3:132256535-132256557 AATTTTCCTTTTTTATGAGGAGG - Intronic
962946464 3:140175201-140175223 AATGTATTTTTTTTATGTAGAGG + Intronic
963562906 3:146888916-146888938 AAATGTTCTTTTTTATTAGGTGG - Intergenic
965189366 3:165508291-165508313 AATAGATTTTTTTTTTGAGATGG + Intergenic
966423789 3:179759677-179759699 AATGCATTTTTTTTTTGAGACGG + Intronic
967371589 3:188752684-188752706 ACTGGAACTTTAATATGAGGCGG - Intronic
967485315 3:190023458-190023480 AATGAACCTTCTTTACGAGGCGG + Intronic
967507149 3:190265424-190265446 AATGAAACTTCTTTATGAGATGG - Intergenic
968164533 3:196453912-196453934 AATGCTTCTTTTTTTTGAGATGG + Intergenic
970593111 4:17576726-17576748 TTTGGATTTTTTTTTTGAGGCGG - Intergenic
971306767 4:25489769-25489791 ATTGGATTTTTTTTATCATGTGG - Intergenic
971881323 4:32377591-32377613 AATGGACCTTTATCATAAGGAGG + Intergenic
972847028 4:43003050-43003072 AAAGGATCTTCTTCATGTGGTGG - Intronic
973371843 4:49256471-49256493 TATGGATTTTTTTTTTGAGTTGG + Intergenic
973389161 4:49538846-49538868 TATGGATTTTTTTTTTGAGTTGG - Intergenic
973748936 4:53993140-53993162 AATAGATCTCATTTAGGAGGTGG - Intronic
974989233 4:69063826-69063848 ATTGGATGTTTCTGATGAGGAGG - Intronic
976780567 4:88754064-88754086 AATGCATTTATTTTATGTGGTGG - Intronic
976885209 4:89974455-89974477 AAAGGATTTTTTTAAGGAGGTGG + Intergenic
977636366 4:99302947-99302969 ATTGGATTTTTTTTTTGAGACGG - Intergenic
977964863 4:103133808-103133830 AATGGATTTTATTGATGAAGTGG - Exonic
978582517 4:110246503-110246525 AATGAATTTTTTTTTTGAGACGG - Intergenic
978957788 4:114635683-114635705 AATGGATCTTTTTTATGAGGGGG - Intronic
979021365 4:115502998-115503020 AGTGGATCTTTATTATTAGTGGG - Intergenic
979520793 4:121664300-121664322 AAAGGATTTTTTTTCTGAGCAGG + Intergenic
980250314 4:130306673-130306695 GGTGGATCTTTTGTATTAGGGGG + Intergenic
982441019 4:155436213-155436235 AATTGGTTTTTTTTTTGAGGGGG - Intergenic
982464957 4:155718694-155718716 AATATGTATTTTTTATGAGGTGG + Intronic
983918157 4:173314533-173314555 ACTGCATCTTTTTGATGAAGTGG - Intronic
986852713 5:11831699-11831721 AGTGGCTCTCATTTATGAGGGGG - Intronic
987251008 5:16101369-16101391 AATGCATTTTTTTTTTGAGATGG - Intronic
987579543 5:19772205-19772227 CATGGATATTTTTGAGGAGGTGG - Intronic
988471153 5:31540042-31540064 CATGCTTCTTTTTTATGAGATGG - Intronic
990020959 5:51127343-51127365 AAGGCATCTTTTTTATAAGGTGG - Intergenic
990909261 5:60837450-60837472 AATCTCTCTTTTTTTTGAGGTGG - Intronic
990958984 5:61373303-61373325 ACTGGGTCTTTTTTTGGAGGGGG + Intronic
991215810 5:64156502-64156524 AATGTAACTTTTTTCTGTGGTGG - Intergenic
991844593 5:70846571-70846593 AATGCATTTTTTTTTTGAGATGG - Intergenic
991874407 5:71146969-71146991 AATGCATTTTTTTTTTGAGATGG + Intergenic
992010753 5:72524957-72524979 AATGGCTCTTCTTCATGAGCTGG - Intergenic
992189854 5:74281148-74281170 ACTGGATTTTTTTTAAGAAGTGG - Intergenic
992222624 5:74587674-74587696 AAAGAATCTTTTCTAAGAGGAGG - Intergenic
992256271 5:74924075-74924097 AATGGATTTTTTTTAAAGGGTGG + Intergenic
992314877 5:75542700-75542722 TATGTATTTTTTTTTTGAGGCGG + Intronic
992385869 5:76284337-76284359 TCTGGATCTATTTCATGAGGTGG + Intronic
993772164 5:91942316-91942338 AATGTATCTGTTTTATATGGGGG + Intergenic
994701134 5:103136634-103136656 AATGAATCTTTTATGGGAGGTGG + Intronic
994972946 5:106765810-106765832 AATATATCTTTTTTATCTGGGGG - Intergenic
995617740 5:113985490-113985512 AATAGATCTTATTTATAAAGAGG + Intergenic
998468974 5:142368431-142368453 AATGGATCATTTTTTGGGGGAGG + Intergenic
998633490 5:143927048-143927070 AATTAATTTTTTTTTTGAGGTGG + Intergenic
998933457 5:147207144-147207166 CATGGAGCATTTTTAGGAGGAGG + Intergenic
999578466 5:153007403-153007425 AATGTATTTTTTATATGAGAAGG + Intergenic
999779831 5:154840392-154840414 AATTGATTTTTTTTAGGAGATGG + Intronic
1000595148 5:163207056-163207078 AATCTATCTTTTTCATCAGGAGG + Intergenic
1000841704 5:166227618-166227640 AAAGGATATTTTTGATGATGAGG + Intergenic
1001693075 5:173647175-173647197 GATGGGTCTTTTTTTTGAGACGG + Intergenic
1002035803 5:176468612-176468634 AAAGGAACTTTCTTTTGAGGAGG - Intronic
1004204742 6:13581952-13581974 AATGGATCTTATCTAAAAGGTGG - Intronic
1005227786 6:23663105-23663127 AATAGATCCATTTTAAGAGGGGG + Intergenic
1006041724 6:31261607-31261629 AATGCAACATTTTTAAGAGGTGG + Intergenic
1007538319 6:42616497-42616519 AATAGATTTTTTTTTGGAGGGGG + Intronic
1008202957 6:48614976-48614998 AATGGATTTTTTTTTTTAGACGG - Intergenic
1008448842 6:51625621-51625643 TAAGGAACTTTTTTATGTGGTGG - Intronic
1011573430 6:88765232-88765254 AATGTATATTTTTTATTAGAAGG + Intronic
1013034592 6:106368245-106368267 TATGTATCTTTTTTAAGAGATGG - Intergenic
1014165012 6:118214438-118214460 AATGAATCATTTTTTTGAGAAGG - Intronic
1015508365 6:134012386-134012408 AATGGAACTCTTTTGTGAGCAGG + Intronic
1016061134 6:139631644-139631666 AATGGCTTTTTGTTATGTGGAGG + Intergenic
1016141132 6:140612391-140612413 AAGTGATATTTTTTAGGAGGAGG - Intergenic
1019904820 7:4053767-4053789 ATTTCATCTTTTTTGTGAGGAGG - Intronic
1020413713 7:7921950-7921972 AATGCATCCTTTTTATTATGTGG + Intronic
1020900108 7:13992872-13992894 AATGGACTTTTTTTTGGAGGGGG - Intergenic
1020976014 7:15007559-15007581 CATGCATCTGTTTTATCAGGTGG + Intergenic
1021016496 7:15541421-15541443 AATGCATTATTTTTATGTGGAGG + Intronic
1021296911 7:18919538-18919560 AATGGGTTGTTTTTATCAGGTGG - Intronic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1023316013 7:38937669-38937691 AATAGATTTGTTTTATGAAGAGG - Intergenic
1023554157 7:41402797-41402819 AATGGCTCTTTCTTATGACAAGG + Intergenic
1024643107 7:51348135-51348157 AAATGATTTTTTTTTTGAGGTGG + Intergenic
1024914166 7:54480294-54480316 AATGGATCTTTTTAATTGTGCGG + Intergenic
1025001654 7:55320374-55320396 TAGGGATCTTTTTTTTGAGACGG - Intergenic
1025551916 7:62261001-62261023 AATGCATTTTTTTTTTGAGATGG + Intergenic
1026083442 7:67242394-67242416 ACTGGGTCTTTTTTTTGAGATGG + Intergenic
1026693604 7:72571635-72571657 ACTGGGTCTTTTTTTTGAGATGG - Intronic
1026730296 7:72905693-72905715 AATAAATCTTTTTTTTGAGATGG - Intronic
1027675859 7:81157609-81157631 AAAGGGTCTTTTTTTTGGGGGGG - Intergenic
1027750429 7:82137853-82137875 AATAAATTTTTTTTTTGAGGCGG - Intronic
1027861161 7:83583765-83583787 AATGTATCTTTTTAATAATGAGG - Intronic
1028827282 7:95288317-95288339 AATGGTGCTTTTTTATTATGGGG + Intronic
1030120099 7:106101461-106101483 CATGTATCTTTTTTGTGGGGGGG - Intronic
1031221887 7:118976954-118976976 AATGAATCTTTCATATAAGGTGG + Intergenic
1032295192 7:130631006-130631028 ATTGGATTTTTTTTAAGAGATGG - Intronic
1033370885 7:140706653-140706675 TGTGGATCTTTTTTTTGGGGGGG + Intronic
1033724617 7:144101260-144101282 AATGGATGTATCATATGAGGGGG - Intergenic
1033800693 7:144898496-144898518 AAAGGAACTTTGTGATGAGGGGG - Intergenic
1035516191 8:234057-234079 AAGGTATCTTTCTAATGAGGAGG + Intronic
1037405235 8:18535509-18535531 AATGCACCTTTTCTGTGAGGAGG - Exonic
1038468203 8:27786234-27786256 AAAGGATCTTTTTAAAGAAGGGG + Intronic
1038516505 8:28191917-28191939 AACTGAGCTTTCTTATGAGGTGG - Intergenic
1038760382 8:30380364-30380386 AAGGGATTTTTTTTTTGAGACGG - Intergenic
1039194939 8:35020462-35020484 AATGGATTGTCATTATGAGGGGG - Intergenic
1039866880 8:41512620-41512642 AATGTATATTTTTTTTGAGATGG + Intergenic
1042387251 8:68191139-68191161 AATGGCTCTTTTTTATTACCAGG - Intronic
1042427632 8:68666917-68666939 AATGCATCTTTTTTATGAAATGG + Intronic
1043267292 8:78282462-78282484 TATGGATTTTTTTTTTGAGACGG + Intergenic
1044110014 8:88261384-88261406 AGTGCATCAGTTTTATGAGGGGG + Intronic
1045255316 8:100515382-100515404 AATGGATTTTTTTTGAGAAGTGG + Intronic
1046438126 8:114221502-114221524 AATGAATCTTATCTAGGAGGAGG + Intergenic
1047441937 8:124886320-124886342 AATGGGTCTTTTTTTTTTGGAGG - Intergenic
1047618548 8:126583317-126583339 TATGGTTTTCTTTTATGAGGTGG + Intergenic
1048498958 8:134958541-134958563 ACTGGAGCTTTTTTTTGAGATGG - Intergenic
1048592852 8:135837602-135837624 AAAGGATATTTTTTTAGAGGGGG - Intergenic
1049142772 8:140972180-140972202 AATGGATTTTTTTTTAGGGGAGG - Intronic
1049957320 9:705584-705606 AATGTATATTTTTTTTGGGGGGG + Intronic
1050149009 9:2600432-2600454 AATCGAACTTTTGTATGATGGGG + Intergenic
1050735210 9:8754138-8754160 AATGAGTCTTTTTTTTGAGATGG - Intronic
1051731596 9:20149042-20149064 AATGGATGTATTTTAACAGGAGG + Intergenic
1052480325 9:29016588-29016610 TATGAATCTTTTTTATAAGTTGG - Intergenic
1052822049 9:33145288-33145310 AATGCACCATTTTTATTAGGAGG - Intronic
1052874510 9:33544831-33544853 AATGAATTTTTTTTTTGAGATGG - Intronic
1053629694 9:39922452-39922474 AATGCATTTTTTTAATGTGGTGG - Intergenic
1054214193 9:62328250-62328272 AATGCATTTTTTTAATGTGGTGG + Intergenic
1054673291 9:67827109-67827131 AATGCATTTTTTTAATGTGGTGG - Intergenic
1054945620 9:70793147-70793169 AATGGGTATTCTTTATAAGGAGG - Intronic
1055252305 9:74322519-74322541 AATGCATTTTTTTTAGGAAGAGG + Intergenic
1055796250 9:79977599-79977621 AATATATTTTTTTAATGAGGTGG - Intergenic
1055965886 9:81864530-81864552 AATAGATTTTTTTTTTGAGGTGG + Intergenic
1056046090 9:82718234-82718256 AATCGATCTTTTTTCAGATGTGG + Intergenic
1056548917 9:87635530-87635552 AATGGACCAGTTTTAGGAGGAGG + Intronic
1056878798 9:90368095-90368117 TATTGATCTTTTTTCTGAAGAGG + Intergenic
1057031718 9:91780784-91780806 AATTTATCTTTTTTTTGAGATGG - Intronic
1057083933 9:92191598-92191620 AATGAATCTTCTTTTTGAGATGG - Intergenic
1059059443 9:111019838-111019860 TATGGAACTTTTTTTTGAGACGG - Intronic
1059737414 9:117116018-117116040 TATGCATTTTTTTTTTGAGGCGG - Intronic
1203425906 Un_GL000195v1:37831-37853 AAGGGCTTTTCTTTATGAGGAGG + Intergenic
1185511706 X:668565-668587 AATTAATCTTTTTTTTGAGATGG + Intergenic
1187394028 X:18904843-18904865 CATTTAGCTTTTTTATGAGGAGG + Intronic
1189158291 X:38782918-38782940 AATGCAGATTTTTTTTGAGGGGG + Intergenic
1189789081 X:44586225-44586247 AAGGGATCTTTGTTATGTGGTGG + Intergenic
1189790124 X:44595941-44595963 AATTTATCTTTTTTTTGAGATGG + Intergenic
1192108408 X:68339264-68339286 CATAGATTTTCTTTATGAGGTGG - Intronic
1192472374 X:71410298-71410320 AATTTATTTTTTTTATGATGAGG + Intronic
1193134847 X:77959174-77959196 AATGGAATTTTTTTTTCAGGTGG + Intronic
1194125052 X:90007090-90007112 TATGGATAGTTTTTATGCGGTGG + Intergenic
1196013919 X:110917382-110917404 AATGGGTCAGTTTTGTGAGGTGG + Intergenic
1196356606 X:114802065-114802087 AATGGACCTTTTTGAAGTGGGGG - Intronic
1196480828 X:116145724-116145746 AATAGACCTTATTAATGAGGTGG + Intergenic
1196643045 X:118085940-118085962 GATGGATTTTTTTTTTGAGACGG + Intronic
1196784413 X:119409617-119409639 TATGGTTCTTTTTTTTGAGATGG + Intronic
1198517368 X:137423340-137423362 CATGGGTCTTTTTAATGAGCGGG - Intergenic
1199484828 X:148336519-148336541 AATAGATCTTTTTCATGACTAGG + Intergenic