ID: 978957989

View in Genome Browser
Species Human (GRCh38)
Location 4:114638520-114638542
Sequence CAAGGAAAACAGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 676}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978957989_978957994 13 Left 978957989 4:114638520-114638542 CCTCCCTCCATCTGTTTTCCTTG 0: 1
1: 0
2: 4
3: 64
4: 676
Right 978957994 4:114638556-114638578 TTTCCATAGTATTTTATTGAAGG 0: 1
1: 0
2: 2
3: 44
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978957989 Original CRISPR CAAGGAAAACAGATGGAGGG AGG (reversed) Intronic
900322521 1:2092203-2092225 GTAGGAAAACAGGGGGAGGGCGG - Intronic
900772856 1:4559516-4559538 CCAGGAAAACCTATGGAGGTGGG - Intergenic
901240691 1:7691449-7691471 CATGGAGAACAGATTGAAGGAGG + Intronic
901745601 1:11371246-11371268 CAAAGGAAACAGATGAAGAGTGG + Intergenic
901793598 1:11667585-11667607 AAAAAAAATCAGATGGAGGGTGG - Intronic
902141042 1:14355624-14355646 CAAGGAGAACACATGGACGCAGG - Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903000108 1:20259185-20259207 GAAGGAGAAGAGATGGAGGTTGG + Intergenic
903786938 1:25867601-25867623 CAAGGAAAAGAGATTCAGGCAGG + Intronic
904390819 1:30184633-30184655 AAAGGAAAGAAGATGGAGGTGGG - Intergenic
904521520 1:31099732-31099754 CAAGGAAAGCAGGGGAAGGGAGG - Intergenic
904644569 1:31956171-31956193 CAAGGAAACTAGATGCAGAGTGG + Intergenic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
904811048 1:33163701-33163723 CAAGGAAAACAGAGGGCCTGAGG + Intronic
904845951 1:33416059-33416081 GAAGGAAAAGAGATGTGGGGAGG + Intronic
904985959 1:34549197-34549219 CACTGAGAACAAATGGAGGGAGG + Intergenic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905872622 1:41413688-41413710 CAAGGAAGAGGGATGGAGGGAGG + Intergenic
906370671 1:45250647-45250669 GAAGGAAGAAAGAAGGAGGGAGG + Intronic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
906660602 1:47578732-47578754 CAAGAAAAAAAGGTGGGGGGAGG - Intergenic
907640516 1:56184552-56184574 CAAGGAAAACACATGGACATAGG + Intergenic
907676418 1:56521712-56521734 AAAGGAAGAGAGAGGGAGGGAGG - Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907841799 1:58165363-58165385 TATGGCAAACAGATGGAGAGAGG - Intronic
908779712 1:67679061-67679083 TAAGAAAAACAGTTGGACGGGGG + Intergenic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
910422042 1:87076194-87076216 CAACCAAAAAAGTTGGAGGGAGG + Intronic
910703920 1:90106167-90106189 CAAAGAAAACCGATGAAGAGGGG - Intergenic
910772959 1:90848188-90848210 CAAGGAAAAGAGTGGGATGGGGG - Intergenic
911540831 1:99156356-99156378 CAAGGAGAACAGATGGACACAGG - Intergenic
912172252 1:107114830-107114852 CATGGAAAGTAGATGGAGGTGGG + Intergenic
912653493 1:111463541-111463563 CAAGTAAAACAGAGAGAGAGAGG + Intergenic
912692975 1:111818591-111818613 CCAGGGGAACAGATGGAGTGCGG + Intronic
914800544 1:150958963-150958985 CAAGGAAAAAATTTAGAGGGCGG - Intronic
915363082 1:155297576-155297598 CACTGAAAATAGATGGGGGGTGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
917514165 1:175693278-175693300 CAAGGGAGACAGGTGGATGGTGG - Intronic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
918300838 1:183202387-183202409 CAAGGATAAAAGAAGGAAGGGGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918660465 1:187081781-187081803 GAAGGAAAAGGGAGGGAGGGAGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919846794 1:201647853-201647875 CAGGTAAAAGAGACGGAGGGAGG - Intronic
919974871 1:202603835-202603857 CAAGGAATCCATATGGAGGATGG - Intronic
920082850 1:203388714-203388736 CATGGATACCAGGTGGAGGGGGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
922033538 1:221826705-221826727 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
922188532 1:223297040-223297062 CAAGGAAAACAGTTTCAGGAAGG + Intronic
922561163 1:226570574-226570596 GAAGGAAGCCAGGTGGAGGGAGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923417334 1:233776192-233776214 AAAGGAGGAGAGATGGAGGGTGG + Intergenic
923558069 1:235017346-235017368 CCAGGAGAACAGATGGAAAGAGG + Intergenic
923840080 1:237661293-237661315 CAATGAAAACACATGGACAGAGG + Intronic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924251266 1:242135562-242135584 CTAGGAAAACAAATGCAGAGAGG + Intronic
924584787 1:245352685-245352707 CAAGGAAAAGTGATAGAGGCAGG + Intronic
924846797 1:247782530-247782552 CAAGGGAGACAGATGTAGGCTGG + Intergenic
1062942054 10:1429884-1429906 CAAGGAAAGGAGATGAGGGGAGG - Intronic
1063149253 10:3321824-3321846 CACGGAAGAAAGATGGAGGCCGG - Intergenic
1063725218 10:8629683-8629705 CAATGAGAACACATGGACGGAGG - Intergenic
1064249784 10:13698073-13698095 CATGGAGAGCTGATGGAGGGAGG + Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1066218642 10:33313990-33314012 GAAGGAAAACGAAAGGAGGGAGG - Intronic
1066410334 10:35162584-35162606 CAAGGAAAGCATGTGGAGGTTGG - Intronic
1067304565 10:45049413-45049435 CAAGGAAAAAAGATGTACTGAGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067440431 10:46306314-46306336 CAAGGAAAGCAGGTGGGGGCAGG - Intronic
1067462448 10:46467653-46467675 AAAGGAAGACGGAGGGAGGGAGG + Intergenic
1067624748 10:47916984-47917006 AAAGGAAGACGGAGGGAGGGAGG - Intergenic
1068219464 10:54025854-54025876 AAATGGAAAAAGATGGAGGGAGG - Intronic
1068425700 10:56860770-56860792 CATGGAAGACAGATGTAGGCTGG + Intergenic
1070050521 10:72884914-72884936 CAAAGATAACAGAGTGAGGGAGG - Intronic
1070521078 10:77254177-77254199 CAAGAAAAACAGAAGATGGGAGG + Intronic
1070574435 10:77666878-77666900 AAAAGAAAAGAGATGGTGGGTGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071116891 10:82232450-82232472 CAAGCAACACAGAGGGAGTGGGG - Intronic
1071335229 10:84594949-84594971 CAAGGAACACAGCTGGCGTGAGG + Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071845984 10:89521682-89521704 CAAGGAAAAATGAAAGAGGGAGG + Intronic
1072763338 10:98076569-98076591 CAAGGAAAACAATTGGAGTGTGG + Intergenic
1073128427 10:101168050-101168072 CAATGAAAACACATGGACGGGGG + Intergenic
1073215521 10:101834055-101834077 CAAGGAGTAGATATGGAGGGAGG - Intronic
1073643444 10:105276042-105276064 CAAGGAAAATACATGGAGCATGG - Intergenic
1073946779 10:108759957-108759979 AAAGGAAAACAGATGAAAGGAGG + Intergenic
1073984604 10:109193784-109193806 CAAGACAAGCAGATGGATGGTGG - Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075098523 10:119489795-119489817 CAAGGAGAAAAGTTGGTGGGAGG + Intergenic
1075365831 10:121887796-121887818 GAAGGAAAAAAGATGGTGAGAGG + Intronic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1076284007 10:129275819-129275841 GAAGGAAGACAAGTGGAGGGAGG - Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078079851 11:8196037-8196059 CAAGGAAAGCAAATGGAAGCAGG + Intergenic
1079049113 11:17137761-17137783 AAAGGAAAGCAGAGGAAGGGTGG - Intronic
1079628591 11:22646821-22646843 GAAGGAAGGAAGATGGAGGGAGG - Intronic
1079705972 11:23618964-23618986 TAGGGAAAAAAAATGGAGGGAGG - Intergenic
1079826399 11:25200956-25200978 GAAGGAAAGAAGAGGGAGGGAGG + Intergenic
1080301986 11:30794805-30794827 CAAGGAAAAGAGATGGGGCTGGG - Intergenic
1080597583 11:33788166-33788188 AAAGGAAATAAGATGAAGGGGGG - Intergenic
1082008373 11:47433883-47433905 AGAGGAAGACAGAGGGAGGGAGG + Intergenic
1083477022 11:62921403-62921425 AAAGGGAAAGAGAGGGAGGGAGG + Exonic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1083985813 11:66214550-66214572 GAAGGAAGGAAGATGGAGGGAGG - Intronic
1084196404 11:67525319-67525341 CAAGGAAAAGGGGTGGAGGTGGG + Intergenic
1084363100 11:68681883-68681905 CAAGAAAGAAAGAAGGAGGGAGG - Intergenic
1084918398 11:72449135-72449157 CAAGCAAAACAGATATGGGGTGG - Intergenic
1085681185 11:78576647-78576669 GAAGGAAGAGAGAGGGAGGGGGG - Intergenic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086830137 11:91551867-91551889 CAAGAAAAACACATTTAGGGTGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087596680 11:100262736-100262758 CAAGGAAAACACATGGACACAGG + Intronic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1088395264 11:109361227-109361249 CTAAGAAAACACATGGGGGGAGG - Intergenic
1088449663 11:109967899-109967921 CAAGGAAGAAAGATGAAGGCCGG - Intergenic
1088506505 11:110532640-110532662 CAAGGAAAAGAGAACGAGAGTGG - Intergenic
1088690610 11:112323480-112323502 CAAGGAAAACACATGGACACAGG - Intergenic
1088970383 11:114769760-114769782 CAAGGAAAACACATGGACACAGG + Intergenic
1089012198 11:115140396-115140418 CATGGAAAAAAGAGGAAGGGTGG - Intergenic
1089372707 11:117972558-117972580 AAAGGAAAAAAAATGGAGGTGGG + Intergenic
1089387844 11:118079680-118079702 CACGGAAAACAGGAGGTGGGAGG - Intronic
1089544634 11:119213907-119213929 CATGGAAAAGGTATGGAGGGGGG + Intronic
1089581948 11:119486920-119486942 CCAGGAAAAGGGATGGATGGGGG + Intergenic
1089760781 11:120721574-120721596 CAAGGCAAGCAGATTTAGGGTGG + Intronic
1090332238 11:125941389-125941411 AATGGAAAGCAGATGGAAGGAGG + Intergenic
1090357804 11:126151576-126151598 CAAGGACCACAGGTAGAGGGAGG + Intergenic
1090627595 11:128619787-128619809 CCAGGAAAACAGATGGGGAAGGG + Intergenic
1090715415 11:129426344-129426366 CATGGAAAACAGATACAGGGTGG - Intronic
1090730432 11:129569104-129569126 CAAGCAAAGCTGATTGAGGGTGG - Intergenic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091578955 12:1768809-1768831 TACTGAAAACAGATGGCGGGAGG + Intronic
1091592024 12:1848243-1848265 CAAGGAAAAGAGAAGGGGAGAGG - Intronic
1091632393 12:2171772-2171794 CTAGGATAACAGGTGGAGAGGGG + Intronic
1091842300 12:3629835-3629857 CAAGGAAAAGACAAGGGGGGGGG + Intronic
1092566327 12:9669898-9669920 CAAGGATAAGAGATGGAATGTGG + Intronic
1092585253 12:9893700-9893722 CAAAGAAAAAAAAGGGAGGGAGG - Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1092983790 12:13824937-13824959 GAAGGAAAACAAATGAAGAGGGG - Intronic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093439387 12:19176208-19176230 GGAGGAAGACAGAGGGAGGGAGG - Intronic
1093490577 12:19700316-19700338 CATTGAGAAGAGATGGAGGGAGG + Intronic
1094555173 12:31492351-31492373 GAAAGAAAACACATGAAGGGTGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094846675 12:34364401-34364423 GAAGGAAAACAGAAACAGGGAGG - Intergenic
1094847040 12:34365883-34365905 CAAGGAAAAGAGAAAGAGCGAGG - Intergenic
1095323899 12:40863943-40863965 GAAGGAGAAGAGAGGGAGGGAGG - Intronic
1095861658 12:46924273-46924295 CAAGGAAAAGGGAAGGAGGTAGG + Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096279584 12:50240906-50240928 CAAGGAAGAGAGAGAGAGGGAGG + Intronic
1096359384 12:50970066-50970088 CGAGGAAAACAAATGGTGAGTGG - Intronic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1096880876 12:54669228-54669250 AAAGGAAAACAGTTGTGGGGTGG + Intergenic
1097198830 12:57260874-57260896 AAAGGAAAAGAAATGGTGGGAGG + Intronic
1097614346 12:61865427-61865449 AAAGGAAGAAAGATGGAGGAGGG + Intronic
1098151321 12:67549908-67549930 CAAGGAGAACACATGGACAGAGG - Intergenic
1098422057 12:70308404-70308426 AGAGAAAGACAGATGGAGGGAGG - Intronic
1099003790 12:77213422-77213444 CAAGAAAAAAAGTGGGAGGGAGG - Intergenic
1099609420 12:84848596-84848618 AAAGGAAGAAAGATGGAGGGAGG + Intergenic
1099726323 12:86432502-86432524 CAAGTAGAAGAGATGGAAGGTGG + Intronic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100475341 12:94930394-94930416 CAAACAAAACAGTTGGAAGGTGG - Intronic
1100889016 12:99103065-99103087 AAAGGAAAACTGCTGGAGGTAGG + Intronic
1100982867 12:100176219-100176241 CAAAGATGACAGATGGAAGGAGG + Intergenic
1101047124 12:100820057-100820079 AAAGGGAAATAGAGGGAGGGAGG - Intronic
1101157114 12:101938358-101938380 AATGGAAAACAGATAAAGGGAGG - Intronic
1101535961 12:105616710-105616732 CAAAGAAAAGAAATGGAAGGAGG - Intergenic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1102622621 12:114208752-114208774 GAAGGAATCCAGAAGGAGGGAGG + Intergenic
1102829372 12:115982521-115982543 AAATGACAACAGCTGGAGGGTGG + Exonic
1102866920 12:116382030-116382052 CAAGGAATGCAGAAGGGGGGTGG - Intergenic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103085009 12:118056085-118056107 CAAGGAGAACCGATGGTGCGGGG - Intronic
1103622237 12:122194621-122194643 AAAGGAAGAAAGAGGGAGGGAGG - Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104980825 12:132572496-132572518 GAAGGAGAGCGGATGGAGGGGGG - Intronic
1105037482 12:132937056-132937078 CAAAGAAAATATATGGAAGGTGG + Intronic
1105618766 13:22046768-22046790 CAACGAATACAGTGGGAGGGAGG - Intergenic
1105631050 13:22168748-22168770 TAAGGAAAACTTATGGGGGGAGG + Intergenic
1106189593 13:27439559-27439581 GAAGAAAAACAAAAGGAGGGAGG + Intronic
1107165001 13:37273417-37273439 GAAGGAAGACAGATGGAGAAAGG - Intergenic
1107688479 13:42928066-42928088 CAAGGACCACAGATAGAGGCTGG - Intronic
1107841381 13:44460638-44460660 CTAGGAAAAGCTATGGAGGGAGG + Intronic
1108321565 13:49295454-49295476 CAAGGACAAAAGGTGGAGGGAGG + Intergenic
1108502835 13:51084133-51084155 CAAGGAATCCAGATGGAGTCAGG + Intergenic
1108790737 13:53966600-53966622 CCATGAAAGCAGCTGGAGGGAGG + Intergenic
1108902403 13:55428022-55428044 CAAGGAAAAGGGTGGGAGGGGGG + Intergenic
1109873995 13:68374120-68374142 AAAGGAAAAGAGAGGGAGGTAGG + Intergenic
1110600962 13:77373281-77373303 GAAGGAAGCCAGATGGAGAGTGG + Intergenic
1110917597 13:81042596-81042618 AAAGGAAGAGAGAGGGAGGGGGG + Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1112251008 13:97780450-97780472 AAAGGAAAAGGAATGGAGGGAGG + Intergenic
1112621463 13:101058124-101058146 AAAGGAAAACACATGGCAGGAGG + Intronic
1112679855 13:101751271-101751293 TAAGGGAAATAGGTGGAGGGAGG + Intronic
1113296449 13:108964189-108964211 CAAGGAAAAAAGAGCAAGGGTGG - Intronic
1113699009 13:112369344-112369366 CAAGGAAAACAGATGAGTGCTGG + Intergenic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114180697 14:20365240-20365262 CAAGAAAGAGAGAGGGAGGGCGG - Intergenic
1114537316 14:23431315-23431337 GGAGAAAAACAGAGGGAGGGAGG + Intronic
1114630400 14:24155846-24155868 AAAGGGAAGCAGAGGGAGGGAGG + Intronic
1114742192 14:25108894-25108916 TAAAGAAAAGAGATGGAGTGAGG + Intergenic
1115054667 14:29108814-29108836 GAAAGAAAAAAGAGGGAGGGAGG + Intergenic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1115727381 14:36231990-36232012 CAATGAGAACACATGGAGAGAGG - Intergenic
1115929806 14:38478323-38478345 CCATGAAAGCAGCTGGAGGGAGG + Intergenic
1116727299 14:48576385-48576407 AAAGAAAAACTTATGGAGGGTGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117745495 14:58865361-58865383 CAAGGAAAATAGGTGGATGTGGG + Intergenic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1118646683 14:67847141-67847163 CAATGAGAATGGATGGAGGGAGG - Intronic
1118749185 14:68794214-68794236 GAAGGTAAAGAGGTGGAGGGAGG + Intronic
1119456478 14:74760353-74760375 AAAGGAAAAGGGAAGGAGGGAGG - Intergenic
1119685582 14:76628441-76628463 CAAGGAAGACAGATTGTGGGTGG - Intergenic
1119847289 14:77839940-77839962 AAAGGAAAAAAGAAGTAGGGAGG + Intronic
1120090376 14:80324995-80325017 CAAGGAAAGCAGGTGCAGTGTGG + Intronic
1121006773 14:90495730-90495752 CAAGGAAAACAGTGGGATGATGG + Intergenic
1122425769 14:101604578-101604600 CAAAGAAAGTGGATGGAGGGAGG + Intergenic
1122792283 14:104189083-104189105 CAACGAACACAGGTGCAGGGGGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1122920472 14:104877860-104877882 GCAGGAAAACAGGTGGCGGGGGG - Intronic
1124351137 15:28956328-28956350 GAGGGAAAACAGATGGGGTGGGG + Intronic
1125209477 15:37196628-37196650 CATGGAAAAGAGTTGGTGGGTGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125617813 15:41031450-41031472 GAAGGAAAAGAGAGGGAAGGAGG + Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126554950 15:49976258-49976280 CAAGGAATTTACATGGAGGGTGG - Intronic
1126860435 15:52877621-52877643 GTAGGAAAAAAGACGGAGGGAGG - Intergenic
1126892015 15:53216584-53216606 CAAGGAGAAGAGATGGATGATGG - Intergenic
1127223211 15:56902106-56902128 GAAGGAATAAAGAAGGAGGGAGG + Intronic
1127389606 15:58494846-58494868 TAAGGAAATCAGATGAAGGGAGG - Intronic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127777219 15:62273969-62273991 CAAAGACAACAAATGGAAGGGGG + Intergenic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129234508 15:74215907-74215929 AAAGAAAAAAAGTTGGAGGGAGG + Intergenic
1129353676 15:74973060-74973082 AAAGGAAAAGAGATGGAAGGAGG - Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130056220 15:80528198-80528220 CAAGGACCACAGCTGGCGGGTGG + Intronic
1130336238 15:82959321-82959343 CAAGGTAAATAGATTCAGGGTGG + Intronic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130668616 15:85890767-85890789 CAAGGAAGGCAGATGGAAAGAGG - Intergenic
1130977628 15:88789480-88789502 CAAGGAATAAAGCTGGAAGGAGG + Intergenic
1131707258 15:95011263-95011285 AAAGGAAGACAGATAGATGGAGG + Intergenic
1132374381 15:101319110-101319132 GAAGGGAAACAGATGTAGAGGGG - Intronic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1132924350 16:2420758-2420780 GAAGGAAAAGAGAGAGAGGGAGG - Intergenic
1133624714 16:7560274-7560296 CAAGGATCAGAGATGTAGGGAGG - Intronic
1133723359 16:8515663-8515685 AAAGGAAGAGAGAGGGAGGGAGG - Intergenic
1134760303 16:16708720-16708742 CAATGAAAACACATGGACGCAGG - Intergenic
1134985768 16:18650485-18650507 CAATGAAAACACATGGACGCAGG + Intergenic
1135105508 16:19645880-19645902 TAAGTAAAACAGATGGGGAGTGG - Intronic
1135542606 16:23343521-23343543 GAAGGAAGAAAGAGGGAGGGAGG + Intronic
1135999230 16:27278317-27278339 AAAGAAAAAGAGAGGGAGGGAGG + Intronic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137465284 16:48702867-48702889 CAAGGAAAGAAGGTGGAGGGAGG - Intergenic
1137720053 16:50622490-50622512 GAAGGCAAACAGAGGGAAGGAGG - Intronic
1138378367 16:56582667-56582689 CAAGGAAAAACGAGGGAGGGAGG + Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1139445490 16:66995678-66995700 CAAGGAAAACAGATGCATGTGGG + Exonic
1139510437 16:67425194-67425216 AACTGAAACCAGATGGAGGGGGG - Intergenic
1139599307 16:67976975-67976997 CAAGGAACCCAGAGGCAGGGTGG - Intronic
1139672667 16:68502334-68502356 CCAGGAACACACGTGGAGGGTGG - Intergenic
1140022225 16:71249325-71249347 AAGGGAAAACAGATGCAGAGAGG - Intergenic
1140045409 16:71437365-71437387 AAAGGAAAAGAAAGGGAGGGAGG + Intergenic
1140257592 16:73350094-73350116 TAAGCAAAACAGTTTGAGGGAGG + Intergenic
1140442994 16:75000774-75000796 GAAGAAAAAAAGATGGAGGGAGG - Intronic
1142312974 16:89324641-89324663 CATGGAAGAAAGATGGAGGCTGG - Intronic
1142946371 17:3432714-3432736 TAAGTAAAACAGATGTGGGGGGG - Intergenic
1143309668 17:5977988-5978010 CAAGGCACACAGCTGGACGGTGG + Intronic
1143761650 17:9108623-9108645 CCAGGAAAGCAGATGTGGGGTGG + Intronic
1146653562 17:34621990-34622012 GAAGGAAGACAGATGTGGGGTGG - Intronic
1147443323 17:40460586-40460608 TAAGGAAAAGAGGTGGGGGGTGG - Intergenic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1147575128 17:41594593-41594615 GAAGGAGGACAGAGGGAGGGAGG + Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1147772941 17:42880088-42880110 CAAGAAATAAAGATGGATGGAGG + Intergenic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147874553 17:43611867-43611889 CAAGGAGGACAGAGGAAGGGAGG - Intergenic
1148081307 17:44968740-44968762 CCAGGAAAACAGAGGGACTGGGG + Intergenic
1148378271 17:47170187-47170209 AAAGGAAGACAGAGAGAGGGAGG - Intronic
1148391577 17:47276525-47276547 CAAAGAAAACAAATGGAAGGAGG + Intronic
1148514272 17:48201328-48201350 CAAGGAAGAGAGAGAGAGGGAGG - Intronic
1148973468 17:51505539-51505561 CCAGGAAAACAGCTGGAAGTGGG - Intergenic
1149189417 17:54041251-54041273 CAAGAAAGAGAGAGGGAGGGAGG + Intergenic
1149352585 17:55806162-55806184 CAAGAAAAACAGAAAGAGAGGGG + Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149985728 17:61345491-61345513 CATGGAAAAATGAAGGAGGGAGG + Intronic
1150269008 17:63850435-63850457 CAAGAAAGAAAGAAGGAGGGAGG + Intergenic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150737148 17:67750793-67750815 CATGTAAAACAGGTGCAGGGTGG - Intergenic
1151080072 17:71319260-71319282 CCAGGTAAACAGGTGGAGTGTGG - Intergenic
1151234167 17:72706640-72706662 GAAGAAAAACAGAAGCAGGGTGG - Intronic
1151284065 17:73097075-73097097 CAAGGCAACAAGATGGTGGGCGG + Intergenic
1151444269 17:74152972-74152994 TAAGAAAAACAGAGAGAGGGTGG + Intergenic
1151547114 17:74799925-74799947 CAAGGTAAACCGTGGGAGGGCGG - Intronic
1151683738 17:75635073-75635095 TGAGGAAAACATATGGGGGGTGG - Intronic
1152128167 17:78459878-78459900 CAAGGACAAGAGCTGGAAGGCGG - Exonic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153267368 18:3284627-3284649 CACTGATAACAGATTGAGGGTGG + Intergenic
1153728382 18:7980999-7981021 CAAGGGGAACTGATGGAGAGGGG - Intronic
1153883967 18:9446688-9446710 AAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1155282394 18:24253151-24253173 CAATGAAAAGACATGGCGGGGGG + Intronic
1155559561 18:27061228-27061250 CAAGAAAACCTGATGCAGGGTGG - Intronic
1156165031 18:34408112-34408134 CAAGGAAAACACATGGACACAGG - Intergenic
1156381057 18:36561727-36561749 CAAAGAAAAAAGATGGAGTGGGG - Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156580663 18:38371212-38371234 GTAGGAAAAGAGGTGGAGGGAGG - Intergenic
1157757529 18:50231957-50231979 CAAGGAAAATGGGTGAAGGGAGG - Intronic
1158305609 18:56102000-56102022 CAAGGAAAACTGTTGGCTGGAGG + Intergenic
1159223165 18:65492262-65492284 CAAGGAGAAAAGATGGAGAGTGG + Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159670663 18:71216994-71217016 CAAGGAATCCAGATGGAGGGTGG - Intergenic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1160684782 19:428657-428679 CAAAGAAAACAGATGCAGACAGG + Intronic
1160692806 19:467557-467579 CAAGGATAAGAGGGGGAGGGAGG + Intronic
1160827087 19:1085632-1085654 AAAGGGAGACAGATGGCGGGGGG - Intronic
1161350778 19:3790309-3790331 CAAGGATGAGAGGTGGAGGGTGG - Intronic
1161567595 19:5012300-5012322 CAAGGAAAACGGGTGGGGGGTGG - Intronic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161930376 19:7335750-7335772 CATGGAAGACAGTTGGAAGGTGG + Intergenic
1162226294 19:9225439-9225461 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
1163214912 19:15869267-15869289 CCAGGAAAAGGGCTGGAGGGTGG + Intergenic
1163504253 19:17695488-17695510 CAAAGAAAAAGGAGGGAGGGAGG + Intergenic
1164573473 19:29390966-29390988 AAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1165248637 19:34513015-34513037 GAAGGAAGGAAGATGGAGGGAGG - Intergenic
1165256182 19:34578385-34578407 GAAGGAAGGAAGATGGAGGGAGG - Intergenic
1165266381 19:34665940-34665962 GAAGGAAGGAAGATGGAGGGAGG + Intronic
1165274018 19:34733026-34733048 GAAGGAAGGAAGATGGAGGGAGG + Intergenic
1165742419 19:38211841-38211863 CAAGGGACAGAGAGGGAGGGAGG + Exonic
1165872066 19:38980142-38980164 CATGTAAAATAGATGAAGGGTGG - Intergenic
1166372069 19:42307411-42307433 CAACAACAAAAGATGGAGGGTGG - Intronic
1166372118 19:42307736-42307758 AAAAAAAAAAAGATGGAGGGTGG - Intronic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167303615 19:48694600-48694622 CAAGGAAAAAAGAAACAGGGTGG - Intergenic
1167367779 19:49064030-49064052 GATGGGAAGCAGATGGAGGGAGG + Intronic
1168188629 19:54720926-54720948 CGAGGACTACAGATGGGGGGAGG + Intergenic
1168250847 19:55141131-55141153 CAAGGGATCCACATGGAGGGAGG + Intronic
1168388656 19:55987803-55987825 GCAGGAATACAGCTGGAGGGAGG - Exonic
925575633 2:5357189-5357211 CATGGAAAATAGAGGGAGGGGGG + Intergenic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
925857134 2:8140170-8140192 AAAGAGAAAGAGATGGAGGGAGG + Intergenic
925861022 2:8174952-8174974 CCAGGAAAAGAGGTGGAGGGTGG - Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
925961125 2:9017584-9017606 CAAGGGAAACGGGTGGAGTGTGG + Intergenic
926116663 2:10217815-10217837 AAAGTAAAACAGATTGAGAGAGG - Intergenic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
926620329 2:15041426-15041448 CAAGAGAAACAGCTGCAGGGTGG + Intergenic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
929103165 2:38337087-38337109 CAAGAAAAAGAGAGGGAGGGAGG + Intronic
929120648 2:38481372-38481394 CAAGAAAAACAGATAGAGGAAGG + Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929548019 2:42868759-42868781 AAAGGAAAACAGAAAGAAGGAGG - Intergenic
929603607 2:43220090-43220112 CAAGCAAAACTGAAGGAGAGCGG + Intergenic
929755174 2:44758247-44758269 CAAAGAAAGTAGATGGAGAGGGG + Intronic
932019886 2:68073685-68073707 CAAGGATAGAAGATGGAAGGGGG - Intronic
933721372 2:85399477-85399499 AAAGGAAGACAGATGGCAGGTGG - Intronic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936432282 2:112474912-112474934 CAAAGAAGAGAGATGGAGGGAGG + Intergenic
936432530 2:112476874-112476896 CAAAGAAAAGACATGAAGGGAGG - Intergenic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
937122409 2:119449989-119450011 GAAGGAAGAAAGAGGGAGGGAGG + Intronic
937292827 2:120792133-120792155 CAAAGAAACCAGGTGGCGGGAGG + Intronic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
939303162 2:140373939-140373961 AAAGGAAAAGAGATGGAGAGAGG - Intronic
939945831 2:148409432-148409454 AAAGGAAAAGGGAAGGAGGGAGG + Intronic
940194106 2:151073887-151073909 CAAGGAAAACACATGGACACAGG - Intergenic
940626308 2:156179747-156179769 CAAGTAAAAGAGAAGGAAGGTGG + Intergenic
941743224 2:169058747-169058769 CAATGAAAACAGATGGACCCAGG + Intergenic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943158805 2:184219640-184219662 CAATGAAACAAGATGGAGGGAGG - Intergenic
943738918 2:191389702-191389724 AAAGGAGAACAGATATAGGGAGG + Intronic
944058621 2:195548316-195548338 GAAGGAAGAGGGATGGAGGGAGG + Intergenic
944160942 2:196658862-196658884 TAAGACAAAAAGATGGAGGGTGG + Intronic
944673064 2:202012205-202012227 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
944711460 2:202338502-202338524 CAAAGAAAAAGGAGGGAGGGAGG - Intergenic
945488100 2:210422406-210422428 GAACAAAAACAGGTGGAGGGAGG - Intergenic
945693066 2:213066316-213066338 CAACGGCAACAGAGGGAGGGAGG + Intronic
945739486 2:213642869-213642891 CATGGAAAAGAGATGTAGGCTGG - Intronic
945825159 2:214712803-214712825 CAAAGAAAAAAAAGGGAGGGTGG - Intergenic
945889582 2:215414324-215414346 GAAGGAAAAGAGATGATGGGAGG - Intronic
946884432 2:224209017-224209039 CAAGGAATACAGAGTGACGGTGG - Intergenic
947064760 2:226210688-226210710 CAAGACAACCAGGTGGAGGGAGG - Intergenic
947232634 2:227903373-227903395 AAAGGAAAGCAGGTGGAGGCTGG + Intronic
947314947 2:228846789-228846811 CAAGGAAAGCAGATCTGGGGTGG + Intergenic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
947669764 2:231928790-231928812 CAAGGAAAGCAAAGGGAGAGGGG - Intergenic
947785896 2:232819803-232819825 TAAGGAAAAAAGATGGAGGGTGG - Intronic
947941201 2:234057152-234057174 CAAGGTAAACAGATTGGGGCAGG - Intronic
948125344 2:235560936-235560958 CATGAGAAACTGATGGAGGGTGG - Intronic
949005067 2:241641249-241641271 TAAGCAACTCAGATGGAGGGGGG + Intronic
1168805662 20:670986-671008 AAAGGAAAACAGAGGCTGGGAGG + Intronic
1168924782 20:1570511-1570533 AAAGGAAAAAAGAGAGAGGGAGG - Intronic
1170468320 20:16643205-16643227 TCAGGATAACAGATGAAGGGTGG + Intergenic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1171157377 20:22888780-22888802 CAATGGAAACAGATTGGGGGTGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172552260 20:35810338-35810360 CATGTAAAACAGGTGAAGGGTGG - Intronic
1173047987 20:39530987-39531009 AAGGGAAAAAGGATGGAGGGAGG - Intergenic
1173541647 20:43857203-43857225 GAAGAAAGAAAGATGGAGGGAGG + Intergenic
1173759169 20:45544839-45544861 CAAGGAAAACAGATTCTGGGTGG - Intronic
1173771098 20:45658910-45658932 CAATGAGAACACATGGACGGGGG - Intronic
1173791199 20:45828803-45828825 CAAGGAATGCAGATGGACAGTGG + Intronic
1174119275 20:48250113-48250135 TATGGAAAAGAGATGGAGGTGGG - Intergenic
1174552891 20:51374379-51374401 CAAGGAAAACAGATGGCCCCAGG - Intergenic
1175293662 20:57894617-57894639 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175293681 20:57894689-57894711 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175474000 20:59256346-59256368 CAAGAAAAACATAAGAAGGGAGG + Exonic
1175610251 20:60345301-60345323 AAAGTAAAACAGATGGGGGTGGG - Intergenic
1175767827 20:61603426-61603448 CTAGGAAAACAAATGCAGGCAGG + Intronic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1175847363 20:62065800-62065822 CGAGGAAAAAAGATGGCGGCGGG - Exonic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178759286 21:35385270-35385292 CAAGGAGAGCAGAAGGAGAGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179669865 21:42939122-42939144 CAAGGAAAAGGGAGGAAGGGTGG - Intergenic
1179713353 21:43275413-43275435 CAAGCAGAGCAGATGGAGGGAGG - Intergenic
1180219592 21:46349803-46349825 AAAGAAAAACAGCTGGAGGTGGG + Exonic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181455250 22:23055879-23055901 CATGGAGAACAGTGGGAGGGAGG + Intergenic
1181597226 22:23923938-23923960 CATGGAAAAAGGATGGTGGGGGG - Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181793427 22:25285270-25285292 AAAGAAAAAAAAATGGAGGGCGG + Intergenic
1181833407 22:25581131-25581153 AAAAGAAAAAAAATGGAGGGTGG + Intronic
1181920513 22:26316945-26316967 AAAGGAAGAAAGAAGGAGGGAGG + Intronic
1182044577 22:27264226-27264248 AAAGGAAGGCAGGTGGAGGGAGG + Intergenic
1183063453 22:35348955-35348977 CAAGGAAAGCAGCTGGGGGCAGG + Intergenic
1183473038 22:38019587-38019609 CAAGGCAGAGAGAGGGAGGGCGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949306025 3:2642235-2642257 CATGGAAGAAAGATGTAGGGTGG + Intronic
949677055 3:6467446-6467468 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
950140290 3:10610696-10610718 AAAGGAAAAGAGATGGGGAGAGG - Intronic
950479992 3:13238198-13238220 AGAGGAAAGCAGGTGGAGGGCGG - Intergenic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
950875439 3:16267283-16267305 GAAGGATAACAGAGGGAGAGGGG - Intronic
950935112 3:16831685-16831707 GAAAGAAAAAAGAGGGAGGGAGG + Intronic
951532256 3:23709120-23709142 CAAGAATAACATATTGAGGGTGG + Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
952433277 3:33246927-33246949 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952933625 3:38378478-38378500 AAAGGAAAGCAGCTGGTGGGCGG + Intronic
953117349 3:40006260-40006282 GAAGGAAAATAGAAGGAGAGAGG + Intronic
953144167 3:40258544-40258566 AAAGGAAAACTGCTGGAGGGAGG + Exonic
953180680 3:40591578-40591600 CAAGGGAAAAAGATGTAGGCTGG + Intergenic
953474703 3:43195474-43195496 CAAGGGAAACAGAGGTGGGGAGG - Intergenic
953859794 3:46533761-46533783 GAAAGAAAAGAGAGGGAGGGAGG - Intronic
954328850 3:49878342-49878364 AAAAGAAAAGAAATGGAGGGTGG - Intergenic
954631427 3:52049705-52049727 AAAGGAAGAGAGAGGGAGGGGGG + Exonic
955524011 3:59802613-59802635 CAAGGAAGGCAGATGGGGTGGGG - Intronic
956360596 3:68442608-68442630 GAAGGAAAAAAGAAAGAGGGAGG + Intronic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
957119204 3:76068039-76068061 GAAGAAATACACATGGAGGGTGG + Intronic
957548371 3:81670250-81670272 CAACGAAAGCAGAGGGAGTGTGG + Intronic
957593760 3:82233830-82233852 AAAAGAAAAGAGATGGAGGAAGG + Intergenic
957886091 3:86289671-86289693 CAAGGAAAATAAATGGAACGAGG - Intergenic
957938074 3:86969341-86969363 CAAGCAAAGCAAATGGAGGGAGG - Intronic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
959478148 3:106837513-106837535 CAAGCCAAACTGATGGAGAGAGG - Intergenic
960159768 3:114338042-114338064 AAAGAAAAAGAAATGGAGGGTGG - Intergenic
960196523 3:114775490-114775512 CAAGGAAAAGAGGTGGAGTAAGG - Intronic
960853307 3:122077957-122077979 CAAGGAACACAGAAGCAAGGTGG - Intronic
963108410 3:141665605-141665627 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963108448 3:141665751-141665773 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963108528 3:141666001-141666023 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
964705167 3:159610547-159610569 TAATGAAAACAGAGGGAGGTAGG - Intronic
965074817 3:163962977-163962999 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
966429956 3:179820876-179820898 GTAGGGAAAGAGATGGAGGGTGG + Intronic
966714715 3:183003813-183003835 CAAGAGAAACAGGTAGAGGGAGG - Intergenic
966855163 3:184188857-184188879 AAAGGAAATCTGAAGGAGGGAGG - Intronic
967182622 3:186919584-186919606 CAAGGACCACAGAGGTAGGGAGG - Intergenic
967218823 3:187232230-187232252 CAAGGAAAAAAAAAGGGGGGGGG - Intronic
967603872 3:191420957-191420979 CAAAGAAAACAGATCGGGGAAGG + Intergenic
967607324 3:191462980-191463002 AAAAGAAAAAAGAGGGAGGGAGG - Intergenic
968789586 4:2650403-2650425 GAAGGAAAACAGAAGGCGAGGGG + Intronic
969025205 4:4167270-4167292 GAAGGACAACTGATGGAGGAAGG - Intergenic
969086165 4:4658067-4658089 TAAGGAAAAGAGATGTAGAGTGG - Intergenic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
969920054 4:10530008-10530030 GAAGGAAAAGGGAAGGAGGGAGG - Intronic
970641321 4:18069488-18069510 CAGGGAAGAGAGGTGGAGGGAGG - Intergenic
970686759 4:18577453-18577475 CAAGGAAGTTAGATGGTGGGAGG - Intergenic
970872313 4:20830024-20830046 AAAGGAGAACTGAGGGAGGGAGG - Intronic
970886648 4:20994021-20994043 CAAGGATAAAAGAAAGAGGGAGG - Intronic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972065661 4:34939877-34939899 CATGTAAAATAGATGAAGGGTGG + Intergenic
974805143 4:66869698-66869720 CAATGAGAACAAATGGACGGAGG + Intergenic
975215426 4:71748320-71748342 CAAGAAAGACAGGTGGTGGGGGG + Intronic
976836581 4:89381220-89381242 GAAGGTAAAGAGGTGGAGGGAGG - Intergenic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
978267931 4:106849592-106849614 TATGTAAAACAGATGAAGGGTGG - Intergenic
978528017 4:109685749-109685771 GAAGGGAAAAAGATGAAGGGAGG - Intronic
978957989 4:114638520-114638542 CAAGGAAAACAGATGGAGGGAGG - Intronic
979348984 4:119624405-119624427 CAAGGAAAAAAAATGAAGGACGG + Intronic
979768403 4:124491185-124491207 CAAGGAAAACAGATAAATGTGGG + Intergenic
980253789 4:130350193-130350215 GAAGGAAAAAGGAAGGAGGGAGG - Intergenic
980795164 4:137673305-137673327 GAAGGAAAAAAAAAGGAGGGTGG - Intergenic
981601251 4:146491526-146491548 AAAAGGAAAAAGATGGAGGGAGG + Intronic
981731078 4:147899132-147899154 CACGGACAAGAGTTGGAGGGCGG + Intronic
982806992 4:159778652-159778674 CAATTAAAACAGATGGAATGTGG - Intergenic
982884021 4:160755631-160755653 GAAGGAAAAGTGATGGAGTGAGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
984516953 4:180752829-180752851 CCATGAAAGCAGCTGGAGGGAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985233658 4:187849416-187849438 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987563095 5:19549624-19549646 GAAGGAAGAAAAATGGAGGGAGG + Intronic
987639533 5:20594865-20594887 CAATGAAAACACATGGACGCAGG - Intergenic
987764040 5:22202112-22202134 GGAGGAAAAGAGAGGGAGGGAGG - Intronic
988405167 5:30815007-30815029 CAAGGGAGACAGATGTAGGCTGG + Intergenic
988953638 5:36291593-36291615 CAAGGAAAACACATGGACACAGG - Intronic
989358568 5:40573074-40573096 CAAGAAAAACAGAACGTGGGAGG - Intergenic
989826435 5:45862455-45862477 GAAGGAAAAGAAATGGAGAGTGG + Intergenic
991507339 5:67339148-67339170 GGAGGAAGACAGAGGGAGGGAGG - Intergenic
991898765 5:71435190-71435212 GGAGGAAAAGAGAGGGAGGGAGG - Intergenic
992070024 5:73139673-73139695 ACAGGAGAACAGGTGGAGGGAGG - Intergenic
992081020 5:73234294-73234316 GAAGGGAAAAAGATGGAGGTGGG - Intergenic
992127685 5:73658486-73658508 GAAGGAGAAGAGATGGATGGAGG + Intronic
992658662 5:78936060-78936082 GAAGGGAAAGAGAGGGAGGGAGG - Intronic
993436187 5:87898540-87898562 TAAGAAAAACAGATGAAGGGAGG + Intergenic
993680843 5:90875552-90875574 CAAGGAAACCAGGTGGTGGTGGG + Intronic
993939895 5:94046015-94046037 ACAGGAAGACAGATGGAGGTGGG + Intronic
994626348 5:102224896-102224918 CAAGGAAAAGAGAGGGAAGAAGG + Intergenic
994681795 5:102897110-102897132 CAAGGAAAACGTATGGAAAGTGG - Intronic
995394573 5:111673585-111673607 CCAGGAAAAAACATGGAGAGTGG + Intronic
995470599 5:112498062-112498084 CAAGGAAAAGAGAGAGACGGAGG - Intergenic
995523037 5:113028883-113028905 CAAGTACCACAGGTGGAGGGCGG + Intronic
996244764 5:121248483-121248505 TAAGTAAAAAAGATGGAGGGTGG - Intergenic
997017049 5:129948331-129948353 CCAGGAAAATAGGTGGAAGGAGG - Intronic
997512375 5:134462414-134462436 CAAGGAGGGCAGATGGTGGGAGG + Intergenic
998189957 5:140015146-140015168 TAAGAAAAAAAAATGGAGGGAGG - Intronic
998261303 5:140633738-140633760 CAAGGAAAAAAAAAGGAAGGGGG - Intergenic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
999692959 5:154164841-154164863 AAAAAAAAAAAGATGGAGGGCGG - Intronic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1001571700 5:172734389-172734411 CTAAGAAAACAGATGAAGAGGGG + Intergenic
1001845818 5:174920125-174920147 CAAGGAGGACAAATGGAAGGGGG + Intergenic
1002892974 6:1352805-1352827 CCATGAAAGCAGCTGGAGGGAGG - Intergenic
1003121325 6:3321145-3321167 CACGGAAAACATATGCATGGAGG - Intronic
1003425420 6:5995489-5995511 AAAGGAAATCGGACGGAGGGAGG - Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003745546 6:8997619-8997641 AAAGAAAAAGAGAGGGAGGGAGG - Intergenic
1003759687 6:9162752-9162774 AAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1003876812 6:10445194-10445216 CAAGGAAAATAAATGGAGACAGG - Intergenic
1003962980 6:11226208-11226230 AAAGTAAATAAGATGGAGGGGGG + Intronic
1004311030 6:14544995-14545017 CAAGGGAATCAGATTGGGGGTGG + Intergenic
1004572211 6:16858203-16858225 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
1004738112 6:18428700-18428722 CAATGAAAACAACTGGGGGGTGG - Intronic
1004748668 6:18538573-18538595 CAAGGCAAAGAAAGGGAGGGAGG - Intergenic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005505296 6:26464124-26464146 CAACCATAACATATGGAGGGTGG + Intronic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1006168098 6:32077322-32077344 CAAAGAAAATAAATTGAGGGTGG + Intronic
1006920909 6:37626441-37626463 CCAGGAACACAGATGCAGGGAGG - Intergenic
1007783996 6:44270216-44270238 CACGGAGAACAGATGGAGAGGGG + Intergenic
1007834214 6:44662392-44662414 CAAGGAAAAGAGAGAGGGGGTGG - Intergenic
1007940642 6:45777896-45777918 CAAGGACAATGGATTGAGGGAGG - Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008497945 6:52152090-52152112 GAAGGAAAGAAGAGGGAGGGAGG + Intergenic
1009000405 6:57706330-57706352 CAATGAAAACACATGGACGCAGG + Intergenic
1009355510 6:62739882-62739904 CATTGAAAGTAGATGGAGGGAGG + Intergenic
1010111129 6:72234477-72234499 CAAGGTAAACAGGTGGAAAGGGG - Intronic
1011484571 6:87828777-87828799 CAAGGAAGAGAGAAGGAGAGGGG - Intergenic
1011606054 6:89106888-89106910 CAAGGAGTAAAGAGGGAGGGTGG - Intronic
1011614196 6:89183098-89183120 CAAGGAAAACATATGCATGGAGG + Intronic
1011761810 6:90575485-90575507 CAAGGAAGACAGACCAAGGGAGG + Intronic
1011938309 6:92810707-92810729 CAAGGTCAACAGATGTAGGTGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012375943 6:98561571-98561593 CCAGGTAGAGAGATGGAGGGAGG - Intergenic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1012984228 6:105857836-105857858 AAAGGAAAACAGATGGAAATAGG - Intergenic
1013661866 6:112306237-112306259 AGAGGAGAAGAGATGGAGGGAGG - Intergenic
1014068089 6:117150445-117150467 CCATGAAAACAGCTGGAGGGAGG - Intergenic
1014529018 6:122537360-122537382 CAAGGAAAACACATGGACACAGG - Intronic
1014748460 6:125228218-125228240 AAAGGAAAGAAGAGGGAGGGAGG + Intronic
1015079675 6:129208704-129208726 GAAGGAAAAGGGAGGGAGGGAGG + Intronic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015571884 6:134630214-134630236 CAAGGAGAACACATGGAGACAGG - Intergenic
1016505007 6:144769449-144769471 TTTGGCAAACAGATGGAGGGAGG - Intronic
1016906454 6:149155237-149155259 AAAGAAAAGTAGATGGAGGGGGG + Intergenic
1017274439 6:152549481-152549503 TATGGAAAACAGAGTGAGGGAGG - Intronic
1017853355 6:158325897-158325919 CCAGGACAACAGGTGGGGGGAGG - Intronic
1018568444 6:165182686-165182708 CAAGGAAAACTGATTCAGGCTGG + Intergenic
1018623228 6:165751542-165751564 CAAGGCAACCAGGTGGAGGTAGG + Intronic
1018993293 6:168691380-168691402 CAAGGAGAACACATGGACGCAGG + Intergenic
1018999395 6:168736112-168736134 GAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1019825541 7:3281300-3281322 CAAGGATAAAAGATGAAGGGCGG + Intergenic
1020777596 7:12474026-12474048 CAAGGAAAAGAGATGGAGTCAGG + Intergenic
1021962348 7:25885402-25885424 GAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1022805474 7:33816984-33817006 CAAGTCACACAGATGGAAGGTGG + Intergenic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1024505428 7:50158252-50158274 CTAGGAAAAGACATGGGGGGTGG - Intronic
1024673736 7:51619885-51619907 ATAGGAGAACAGCTGGAGGGAGG + Intergenic
1024799319 7:53057899-53057921 CAAGGAAGAAAGAAAGAGGGAGG - Intergenic
1026231162 7:68485329-68485351 AAAGGAAAAGGGAGGGAGGGAGG + Intergenic
1027357407 7:77371413-77371435 AAAAGAAAAAAGATGGAGGACGG - Intronic
1027542697 7:79487925-79487947 CATGACAAACAGATGGATGGAGG - Intergenic
1028210577 7:88069240-88069262 GAAGGAAAGCAGAAGGAGAGAGG - Intronic
1028309533 7:89313804-89313826 CAAGGAAAAGAAAGGGAAGGTGG - Intronic
1028538291 7:91913916-91913938 GAAGGAAAACAGAGGCAGGGAGG + Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029144982 7:98439349-98439371 AAAGAAAGACAGAAGGAGGGAGG - Intergenic
1029412897 7:100426976-100426998 GAAGGAGAAGAGAGGGAGGGAGG - Intronic
1029412922 7:100427040-100427062 GAAGGATAAGAGAGGGAGGGAGG - Intronic
1029689995 7:102174962-102174984 CAAAAAAAACAGATAGAGGGAGG + Intronic
1030365504 7:108641374-108641396 GAAAGAAAAAAGAGGGAGGGAGG - Intergenic
1030632635 7:111912617-111912639 GAAGGAAAGAAGATGGAGGAGGG + Intronic
1030906285 7:115187407-115187429 CAATGAAAACAGATGGACACAGG - Intergenic
1032008222 7:128321597-128321619 CAAGGGAACAAGATGGTGGGTGG + Intronic
1034224241 7:149470541-149470563 CAATGGAAAGAGTTGGAGGGAGG + Intergenic
1034278122 7:149833004-149833026 CAAGGAAGAAGGATGGAGTGAGG - Intergenic
1034752776 7:153586512-153586534 CAATGAAAACACATGGGGGCAGG - Intergenic
1034843562 7:154422228-154422250 CAAGGAAATCAGGTTGAGGCTGG + Intronic
1034923602 7:155103341-155103363 CTAGGAAGAAAGATTGAGGGAGG + Intergenic
1034995127 7:155572142-155572164 GAAGGAGGAAAGATGGAGGGAGG + Intergenic
1035168972 7:157007455-157007477 CAAGGAAAACATTTGGAAGGTGG - Intronic
1035823747 8:2622260-2622282 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1036538166 8:9672857-9672879 AAAGGAAGACGGAAGGAGGGAGG - Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037241199 8:16780297-16780319 CAATGCAAAGAGATGCAGGGTGG - Intergenic
1038593321 8:28861273-28861295 ATAGGGAACCAGATGGAGGGTGG - Intronic
1039033397 8:33333259-33333281 GAAGGAAAACAGAGGCAGAGTGG + Intergenic
1039164863 8:34666920-34666942 CAAAGAAAAAAGTGGGAGGGGGG - Intergenic
1039306804 8:36272182-36272204 AAAAGAAAGCAGATGGAGGAGGG - Intergenic
1039872463 8:41558018-41558040 CATGGAAGAAAGATGTAGGGTGG - Intergenic
1040472372 8:47744988-47745010 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
1040931528 8:52740215-52740237 CAAAGAAAACAGGAAGAGGGTGG + Intronic
1042936801 8:74067503-74067525 CAAAAAAAACACATGGAAGGCGG - Intergenic
1043674080 8:82927449-82927471 AAAGAAAAACAGAAGGAAGGAGG + Intergenic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044812690 8:96080244-96080266 CAAGGATATCAGATGGAGAGGGG - Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046345108 8:112913650-112913672 AAAGAAAAACAGAGGGAGAGGGG - Intronic
1046349731 8:112992246-112992268 AAAGAAAAAAAGATAGAGGGAGG - Intronic
1047009363 8:120654288-120654310 CTAGGAAAAAAGAGGGAGGGAGG + Intronic
1047556451 8:125936725-125936747 TTAGGAAAACAGGTGGAGGGTGG + Intergenic
1047597629 8:126394832-126394854 CAAGGATAAGAGTGGGAGGGAGG - Intergenic
1047978659 8:130157472-130157494 CAAGGAGACCAGTTAGAGGGAGG - Intronic
1048077790 8:131092308-131092330 CAAGAAAAACAGGTAGAAGGCGG - Intergenic
1048396541 8:134019513-134019535 CAAGGGAAAGAGTTGGTGGGAGG + Intergenic
1048580660 8:135727725-135727747 AAAGGAAGAGAGAAGGAGGGAGG + Intergenic
1049064268 8:140300718-140300740 GAAGGAAGATAAATGGAGGGAGG + Intronic
1049160373 8:141093948-141093970 CGAGGAAAAGACAGGGAGGGAGG + Intergenic
1049210764 8:141385445-141385467 GAAGGGAAAAAGAGGGAGGGAGG - Intergenic
1050170414 9:2810075-2810097 GAAGGAAAACAGAGAGAGTGAGG + Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050623027 9:7474417-7474439 CCAGCAAAACAGAAGGATGGGGG + Intergenic
1051056032 9:12987121-12987143 CAAGCAAACAAGATAGAGGGAGG + Intergenic
1051685850 9:19657547-19657569 CAAAGAATACACAGGGAGGGTGG - Intronic
1051826772 9:21231106-21231128 CAATGAAAACAGAGGTAGAGGGG + Intronic
1051996157 9:23220131-23220153 TAAGTAAAACAGGTGAAGGGTGG + Intergenic
1052207113 9:25855598-25855620 CAATGAAAACAGATGGACACAGG - Intergenic
1052376260 9:27721157-27721179 CCAGGAACACAGATGTAGGAGGG + Intergenic
1052409702 9:28107082-28107104 CAAGGAAACCATCTGGAGGAGGG - Intronic
1052660504 9:31422903-31422925 CAAGCAAAATAGAGAGAGGGCGG + Intergenic
1052799943 9:32957634-32957656 GAAGAAAAACAGCTGGAGGAGGG + Intergenic
1053209979 9:36219382-36219404 GAAGGAAAAGAGATGGGGAGTGG - Intronic
1053393065 9:37750166-37750188 TATGGCAAACAGATGGAGTGGGG + Intronic
1055045858 9:71923143-71923165 TATGGAAACCAGATGGATGGTGG - Intronic
1056261709 9:84855225-84855247 CATGGGAAACAGATTGGGGGAGG + Intronic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056917129 9:90755790-90755812 GAAGGACAAGTGATGGAGGGAGG - Intergenic
1057425788 9:94948497-94948519 CAAAGATAAGAGATGGGGGGCGG - Intronic
1057602592 9:96471720-96471742 TAATGAAAAGAGAGGGAGGGAGG - Intronic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1057694795 9:97315484-97315506 CAAGGAAAGCAGCTGTGGGGAGG - Intronic
1057871394 9:98720849-98720871 CAAGGAAGACAGGTGGGGTGAGG + Intergenic
1059109716 9:111544153-111544175 CTAGGAAAATAGATGGGGGCTGG + Exonic
1059507265 9:114810967-114810989 CAAGAGAACCAGATGGGGGGAGG - Intergenic
1059603595 9:115808782-115808804 CAAGGAAAATGGATGGAGGTGGG + Intergenic
1059688925 9:116665030-116665052 CAAGAAAGAGAGAGGGAGGGAGG - Intronic
1060696096 9:125710421-125710443 GAAGGAAAGCAGAAGGATGGAGG + Intergenic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1061057155 9:128229913-128229935 AAAGGAAAAAAAAGGGAGGGTGG + Intronic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1061970233 9:134040985-134041007 CAAGGAAGACAGAGGGCGGGTGG + Intronic
1062050638 9:134444754-134444776 GAAGGAGAAAAGAAGGAGGGAGG - Intergenic
1203446734 Un_GL000219v1:63742-63764 AAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1185610977 X:1393365-1393387 AAAGGAAAAGAGAGGGAAGGAGG - Intergenic
1185644072 X:1604643-1604665 AAAGGAAAAGAAAGGGAGGGAGG - Intergenic
1185659982 X:1719924-1719946 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
1185989349 X:4875706-4875728 CAAGGGAGAAAGATGGAGGCTGG - Intergenic
1186040634 X:5474051-5474073 CAAGGAAAACAGGTGATGAGGGG + Intergenic
1186432287 X:9515102-9515124 CCAGGCAGACTGATGGAGGGGGG + Intronic
1186981116 X:14958584-14958606 CCAGGAAAAAAGGTGGAGGCAGG + Intergenic
1187293823 X:17979919-17979941 CAATGAAAACACATGGATGCAGG - Intergenic
1187504644 X:19869029-19869051 AAAGGAAATGAGATGAAGGGAGG + Intronic
1189255127 X:39632034-39632056 CCAGGCAAAGAGATGTAGGGAGG + Intergenic
1189277042 X:39794295-39794317 GAAGGCACACAGATGGAGGTGGG + Intergenic
1189528741 X:41856322-41856344 CCAAGAAAGCAGATGGAGAGTGG + Intronic
1189966674 X:46380437-46380459 GAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1192831105 X:74751778-74751800 GAAGGAAAGAAGAGGGAGGGAGG - Intronic
1192877313 X:75245285-75245307 AAAGGAAAACAGATAGATGCTGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193203947 X:78725843-78725865 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
1193786588 X:85767085-85767107 CAATGAGAACACATGGAGAGAGG - Intergenic
1194140506 X:90203448-90203470 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1194604842 X:95965668-95965690 CATGGGAAAAAGATGTAGGGTGG + Intergenic
1195033710 X:100951252-100951274 AAAGGAGGACAGAGGGAGGGAGG + Intergenic
1195547345 X:106127109-106127131 CAAGGAAGAAAGATGTAGGCTGG + Intergenic
1195996938 X:110741045-110741067 AAAGGAAAACAGATCCATGGAGG + Intronic
1196212766 X:113013688-113013710 AAAGAAAGACAGACGGAGGGAGG + Intergenic
1196834478 X:119801831-119801853 CAAGGAAAAGAGTGAGAGGGAGG - Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1197814708 X:130485246-130485268 CTAGGCAAACAAATGGAAGGTGG - Intergenic
1199144142 X:144346375-144346397 CATGGAAAAAAGATGTAGGCTGG + Intergenic
1199695735 X:150341705-150341727 AAAGGGAAAGAGAGGGAGGGGGG - Intergenic
1200379739 X:155822297-155822319 AGAGGAAAAGAGAGGGAGGGAGG + Intergenic
1200486252 Y:3772411-3772433 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1201235371 Y:11905147-11905169 AAAGGAAAAGGGAAGGAGGGAGG + Intergenic
1201538898 Y:15084727-15084749 GAAAGAAAAAAGAGGGAGGGAGG + Intergenic
1202378903 Y:24259946-24259968 CAAGGGAAACGGATGGTGGAAGG - Intergenic
1202491879 Y:25410175-25410197 CAAGGGAAACGGATGGTGGAAGG + Intergenic