ID: 978959317

View in Genome Browser
Species Human (GRCh38)
Location 4:114656843-114656865
Sequence ATATCTACTTACTGTAGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978959312_978959317 13 Left 978959312 4:114656807-114656829 CCAGGTTTCAATACTTTATCTGC 0: 1
1: 0
2: 3
3: 12
4: 179
Right 978959317 4:114656843-114656865 ATATCTACTTACTGTAGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 121
978959311_978959317 29 Left 978959311 4:114656791-114656813 CCTGATGAATCTGAGGCCAGGTT 0: 1
1: 0
2: 1
3: 13
4: 145
Right 978959317 4:114656843-114656865 ATATCTACTTACTGTAGGTACGG 0: 1
1: 0
2: 0
3: 3
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978959317 Original CRISPR ATATCTACTTACTGTAGGTA CGG Intronic
906775899 1:48529407-48529429 ATATCTACTTCCTATATTTATGG - Intergenic
909267741 1:73582671-73582693 ACATCTACTTAATGTTGGTTAGG + Intergenic
912269525 1:108194683-108194705 AGACCTACTTACTATAGGGAGGG + Intronic
916184939 1:162121909-162121931 ATTTCTAAATACTGTAGTTAAGG + Intronic
916451908 1:164928824-164928846 ATCCCCTCTTACTGTAGGTAGGG + Intergenic
916514270 1:165500701-165500723 ATTGCAACCTACTGTAGGTAAGG - Intergenic
919577639 1:199331632-199331654 TTATCTTCTTACTGTATGTTGGG + Intergenic
923730849 1:236548130-236548152 ACATCCACTTACTGGAAGTAAGG + Exonic
1066137280 10:32462073-32462095 ATATTTTCTTAATATAGGTAAGG - Intronic
1068818845 10:61349657-61349679 AAATCTACTTACTGTTGCAATGG - Intergenic
1068837470 10:61570214-61570236 ATTCCTACTTACTTTATGTAAGG - Intergenic
1074926043 10:118072605-118072627 AGTTCTATTTACAGTAGGTATGG - Intergenic
1092633926 12:10418871-10418893 ATTTCTACTTACTGGAGAAAAGG + Intronic
1093666384 12:21818140-21818162 GTATGCACTTACGGTAGGTATGG - Exonic
1094068122 12:26383064-26383086 ATCACTCCTTACTGTAGGGAGGG - Intronic
1095344207 12:41130370-41130392 ATATCTACTTACTGTCACAATGG - Intergenic
1097588952 12:61549990-61550012 AAAACTACTCACTGTAGGCAGGG + Intergenic
1098981910 12:76965445-76965467 GCAAATACTTACTGTAGGTAAGG + Intergenic
1100559444 12:95733525-95733547 ATATCTACCTTTTGTAGTTATGG - Intronic
1104477706 12:129084178-129084200 TTATCTAGTTACTGTAGCCAAGG - Intronic
1105785449 13:23744181-23744203 AAATCATTTTACTGTAGGTAAGG + Intronic
1105988874 13:25597946-25597968 ATATGTACTTACTCTAGGACTGG + Intronic
1107536023 13:41333457-41333479 AAATCTACTTTCTGTACCTATGG + Intronic
1107576978 13:41734952-41734974 ATATCTATTTTCTGTATTTACGG + Intronic
1110704105 13:78585671-78585693 ATACCTACTTTATGTGGGTAAGG + Intergenic
1111270787 13:85881532-85881554 ATAGCTACTTCCTGTTGCTATGG - Intergenic
1111963017 13:94832423-94832445 CTATCTACTTACTCTATGTATGG + Intergenic
1111970237 13:94905759-94905781 ATCCCTACTCACTGTAGTTATGG + Intergenic
1115243204 14:31269754-31269776 AAATCTACTTCCTGTCTGTATGG + Intergenic
1116201482 14:41803284-41803306 AAAACCAATTACTGTAGGTACGG - Intronic
1117407936 14:55422554-55422576 ATAGCAACTTTCTGTAGGTGGGG + Intronic
1120411064 14:84156299-84156321 ATATCTTCTTACTGATTGTACGG + Intergenic
1126702287 15:51379170-51379192 ATAACTAATTACTCTAGCTAGGG - Intronic
1128004269 15:64223974-64223996 ATCTCTACTTAGAGTAGTTAGGG - Intronic
1131725362 15:95216879-95216901 TTATCTACTTTCTGCAGGTCTGG + Intergenic
1133554163 16:6888939-6888961 TCACTTACTTACTGTAGGTATGG + Intronic
1133597240 16:7304469-7304491 TTATGTACTTACAGCAGGTAAGG + Intronic
1136987516 16:35123962-35123984 ACATTTACTTACTGCAAGTAAGG + Intergenic
1139074257 16:63424296-63424318 ATATCCATTTAAAGTAGGTAAGG + Intergenic
1140853681 16:78958382-78958404 ATATATACTTACTGTAAAAATGG + Intronic
1144116164 17:12093405-12093427 ATATATCCTTTCTGTAGCTACGG + Intronic
1145116675 17:20216733-20216755 AGATCAACTTTCTGTAGATATGG - Intronic
1147354171 17:39879600-39879622 ATATCTAGTTACCTTAGGTTTGG - Intergenic
1155161698 18:23201545-23201567 TTATCTACTTTCTGTCTGTATGG - Intronic
1159203638 18:65221983-65222005 ATTGCTACTTACTTTAGGTTAGG + Intergenic
925989592 2:9243529-9243551 ATATCTGCTTTCTGTACGTCAGG + Intronic
926472203 2:13274554-13274576 ATATCTAATGAATGTATGTATGG - Intergenic
926774201 2:16406023-16406045 ATATCTACTCACTACAGTTAAGG + Intergenic
926974701 2:18502828-18502850 ATATCTTCTTGCTTTAGGTGTGG + Intergenic
934030197 2:88038181-88038203 ATATGTATTTACTGTAAGGAAGG + Intronic
935415240 2:102809146-102809168 ATATCTTCAAACTTTAGGTATGG + Intronic
935564148 2:104589189-104589211 ATAGATACTTACTCCAGGTACGG - Intergenic
936133911 2:109872426-109872448 TAATCTACTTTCTGTATGTATGG + Intergenic
936210786 2:110499059-110499081 TAATCTACTTTCTGTATGTATGG - Intergenic
939735356 2:145837397-145837419 ATATCTACTTAATTTAGCTAAGG - Intergenic
940605777 2:155923220-155923242 ATATATACTTACTCCAGATATGG - Intergenic
942683873 2:178510402-178510424 ACATCTACTGGCGGTAGGTAAGG - Exonic
944186551 2:196955364-196955386 AAATCTATTTTCTGTAGCTATGG - Intergenic
945831213 2:214788526-214788548 ATATATAATTACTGTAATTAAGG - Intronic
946949420 2:224856744-224856766 ATATCTGCTTTCTGGAGGTTTGG + Intronic
948448462 2:238052369-238052391 ATATCTATTGACTGTAGGCCAGG - Intronic
1171569317 20:26233292-26233314 ATGACTACTGGCTGTAGGTAAGG - Intergenic
1174721879 20:52821461-52821483 ATATCAACTGACTCTAGGAAAGG + Intergenic
1179335469 21:40447651-40447673 ATAACTCCTTACTGTGGTTATGG + Intronic
957278143 3:78115520-78115542 ATATTTACAGACTATAGGTAAGG + Intergenic
958030975 3:88109340-88109362 ATATATACTAACTGAAGGTTTGG - Intronic
959154827 3:102654171-102654193 ATATCTACTTATTGCATGTCAGG + Intergenic
960453949 3:117846513-117846535 ATTTCTGCTTCCTGTAGGCATGG - Intergenic
961966395 3:130908911-130908933 ATTTCTACATATTGTAAGTATGG + Intronic
962881517 3:139581649-139581671 ATATCTACTTATTATAGATTAGG - Intronic
966927276 3:184652963-184652985 TTATCTAGTTCCTGAAGGTAAGG - Intronic
971555435 4:28008282-28008304 AAATCTACTTATTGTATCTATGG + Intergenic
971705451 4:30036545-30036567 ATAGCTAATTACCTTAGGTAAGG - Intergenic
972223055 4:36978338-36978360 CTGTCTACTCACTATAGGTAGGG + Intergenic
972414744 4:38827468-38827490 ATATCTTCTTTTTCTAGGTAAGG + Exonic
973072594 4:45883219-45883241 TTATCTCCTTACTGGATGTATGG - Intergenic
974909304 4:68097190-68097212 ATAACAAATTACTGTAGGTTTGG + Intronic
974922877 4:68264102-68264124 TTCTTTACTTACTGTAGGTCAGG - Intergenic
975781225 4:77841904-77841926 ATGTCTGCTTACTACAGGTATGG + Intergenic
976445025 4:85120087-85120109 ATGTCAACTCACTGAAGGTAGGG + Intergenic
977546382 4:98385941-98385963 ATTTATACTTACTGTAGATGTGG + Intronic
978959317 4:114656843-114656865 ATATCTACTTACTGTAGGTACGG + Intronic
982051196 4:151504070-151504092 ATCTCGAGTTACTGTTGGTAAGG - Intronic
986503445 5:8425842-8425864 CTGTCTACTTACTGTCGGTGAGG - Intergenic
989325277 5:40186170-40186192 ATATATTCTTATTGTAGGAAAGG - Intergenic
991726090 5:69537131-69537153 ATATCTATACAATGTAGGTATGG - Intronic
991868866 5:71090735-71090757 ATATCTATACAATGTAGGTATGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993154931 5:84210733-84210755 ATATCTACAGGCTGTATGTATGG + Intronic
993319973 5:86459639-86459661 ATATACACTTACTTTAGATATGG + Intergenic
994127151 5:96180748-96180770 ATATTTAATTACTGTAGTTGAGG + Intergenic
1000883144 5:166720212-166720234 TTATCTACTTACTGTTGGGGAGG - Intergenic
1001397262 5:171426321-171426343 ATTTCTCCTTTCTGTGGGTAAGG + Intronic
1001864112 5:175088186-175088208 ATGTCTAATTAGTGTATGTATGG + Intergenic
1006760429 6:36455862-36455884 ATAGTTACTTACTTTAAGTAAGG - Intronic
1009170052 6:60387306-60387328 ATATCTACTTTTTGTAAGAATGG + Intergenic
1010108855 6:72200768-72200790 ATTTCTTCTTACTGTGGATATGG + Intronic
1010520389 6:76825153-76825175 ATATATACTAATTGTATGTACGG - Intergenic
1010870556 6:81032065-81032087 ATAGCTAATAACTGTAGTTATGG + Intergenic
1012660603 6:101885696-101885718 ATATCTACTAACTGAGGATATGG + Intronic
1013144526 6:107374825-107374847 ATTTTTACTTATGGTAGGTAAGG + Intronic
1014195176 6:118548153-118548175 AGAACTTCTTACTTTAGGTATGG - Intronic
1032000836 7:128264410-128264432 ATATCCACTTTCTATAGATATGG + Intergenic
1040001357 8:42579116-42579138 ATATATATTTATTATAGGTAAGG - Intergenic
1041429805 8:57766675-57766697 ATATATACTCACTGAAGGTGAGG + Intergenic
1042299062 8:67256418-67256440 ATATATTCTTACTTTAGGTTTGG + Intronic
1044840195 8:96330664-96330686 ATATCTACTAAATGAAGGTCAGG - Intronic
1046448195 8:114352416-114352438 ATATATAATTCATGTAGGTAAGG + Intergenic
1053464755 9:38297598-38297620 ATACCTACTTACAGGAGGTGTGG + Intergenic
1055021954 9:71679624-71679646 ACAGTTACTTGCTGTAGGTATGG - Intergenic
1055760316 9:79600027-79600049 ATATCTACTTACTATTTGTCAGG - Intronic
1057948469 9:99350756-99350778 ATTTCTACATTCTGTAAGTATGG - Intergenic
1058500771 9:105613407-105613429 AATTCTTCTTACTGAAGGTAGGG + Intronic
1059807454 9:117818179-117818201 ATGTTTACATACTGTTGGTAGGG - Intergenic
1188432112 X:30115953-30115975 ATACATACTTATTGAAGGTAAGG + Intergenic
1191822965 X:65333136-65333158 ATCTTTACTTACTACAGGTAAGG + Intergenic
1192013920 X:67307482-67307504 ATATCTGCTAACAGTAGGTATGG - Intergenic
1193569556 X:83126161-83126183 ATATCCACATTGTGTAGGTAAGG - Intergenic
1193799842 X:85921674-85921696 ATGCCTACTTACTGTTGGAATGG - Intronic
1199513616 X:148651007-148651029 ATATATACTCACTTTGGGTAAGG + Intronic
1200968618 Y:9125860-9125882 ATTTCTACCTTCTGTAGCTATGG - Intergenic
1201796524 Y:17902571-17902593 ATAGCCACTTACTGTGGATATGG - Intergenic
1201805031 Y:18003414-18003436 ATAGCCACTTACTGTGGATATGG + Intergenic
1202357909 Y:24071633-24071655 ATAGCCACTTACTGTGGATATGG - Intergenic
1202512869 Y:25598480-25598502 ATAGCCACTTACTGTGGATATGG + Intergenic