ID: 978963301

View in Genome Browser
Species Human (GRCh38)
Location 4:114710352-114710374
Sequence GTGGATTAGCTTTAGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978963301_978963304 -9 Left 978963301 4:114710352-114710374 CCATCCAGCTAAAGCTAATCCAC No data
Right 978963304 4:114710366-114710388 CTAATCCACAGACCAGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978963301 Original CRISPR GTGGATTAGCTTTAGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr