ID: 978963410

View in Genome Browser
Species Human (GRCh38)
Location 4:114711889-114711911
Sequence GTGAACAATACAATATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978963405_978963410 8 Left 978963405 4:114711858-114711880 CCACACTCCCTTTCTTTCCTGGA No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data
978963402_978963410 22 Left 978963402 4:114711844-114711866 CCCGACTTACTTCTCCACACTCC No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data
978963406_978963410 1 Left 978963406 4:114711865-114711887 CCCTTTCTTTCCTGGAAGCCAGA No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data
978963401_978963410 30 Left 978963401 4:114711836-114711858 CCTTAAAGCCCGACTTACTTCTC No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data
978963403_978963410 21 Left 978963403 4:114711845-114711867 CCGACTTACTTCTCCACACTCCC No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data
978963407_978963410 0 Left 978963407 4:114711866-114711888 CCTTTCTTTCCTGGAAGCCAGAT No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data
978963408_978963410 -9 Left 978963408 4:114711875-114711897 CCTGGAAGCCAGATGTGAACAAT No data
Right 978963410 4:114711889-114711911 GTGAACAATACAATATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978963410 Original CRISPR GTGAACAATACAATATCTGC AGG Intergenic
No off target data available for this crispr