ID: 978966848

View in Genome Browser
Species Human (GRCh38)
Location 4:114750914-114750936
Sequence AATTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978966848_978966851 3 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966851 4:114750940-114750962 CTCCTTTTGAGACAGCTCTTGGG No data
978966848_978966855 20 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966855 4:114750957-114750979 CTTGGGCTTTTACTGGGCTTTGG No data
978966848_978966854 14 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966854 4:114750951-114750973 ACAGCTCTTGGGCTTTTACTGGG No data
978966848_978966850 2 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966850 4:114750939-114750961 TCTCCTTTTGAGACAGCTCTTGG No data
978966848_978966856 23 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966856 4:114750960-114750982 GGGCTTTTACTGGGCTTTGGTGG No data
978966848_978966853 13 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978966848 Original CRISPR AATTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr