ID: 978966850

View in Genome Browser
Species Human (GRCh38)
Location 4:114750939-114750961
Sequence TCTCCTTTTGAGACAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978966849_978966850 -2 Left 978966849 4:114750918-114750940 CCATCTTCTGCAGATAATTGTTC No data
Right 978966850 4:114750939-114750961 TCTCCTTTTGAGACAGCTCTTGG No data
978966846_978966850 25 Left 978966846 4:114750891-114750913 CCTCTAGGATTTTGGAGCAAGGC 0: 143
1: 187
2: 148
3: 132
4: 240
Right 978966850 4:114750939-114750961 TCTCCTTTTGAGACAGCTCTTGG No data
978966847_978966850 3 Left 978966847 4:114750913-114750935 CCCTGCCATCTTCTGCAGATAAT No data
Right 978966850 4:114750939-114750961 TCTCCTTTTGAGACAGCTCTTGG No data
978966848_978966850 2 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966850 4:114750939-114750961 TCTCCTTTTGAGACAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978966850 Original CRISPR TCTCCTTTTGAGACAGCTCT TGG Intergenic
No off target data available for this crispr