ID: 978966853

View in Genome Browser
Species Human (GRCh38)
Location 4:114750950-114750972
Sequence GACAGCTCTTGGGCTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978966847_978966853 14 Left 978966847 4:114750913-114750935 CCCTGCCATCTTCTGCAGATAAT No data
Right 978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG No data
978966848_978966853 13 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG No data
978966849_978966853 9 Left 978966849 4:114750918-114750940 CCATCTTCTGCAGATAATTGTTC No data
Right 978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978966853 Original CRISPR GACAGCTCTTGGGCTTTTAC TGG Intergenic
No off target data available for this crispr