ID: 978966854

View in Genome Browser
Species Human (GRCh38)
Location 4:114750951-114750973
Sequence ACAGCTCTTGGGCTTTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978966847_978966854 15 Left 978966847 4:114750913-114750935 CCCTGCCATCTTCTGCAGATAAT No data
Right 978966854 4:114750951-114750973 ACAGCTCTTGGGCTTTTACTGGG No data
978966848_978966854 14 Left 978966848 4:114750914-114750936 CCTGCCATCTTCTGCAGATAATT No data
Right 978966854 4:114750951-114750973 ACAGCTCTTGGGCTTTTACTGGG No data
978966849_978966854 10 Left 978966849 4:114750918-114750940 CCATCTTCTGCAGATAATTGTTC No data
Right 978966854 4:114750951-114750973 ACAGCTCTTGGGCTTTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978966854 Original CRISPR ACAGCTCTTGGGCTTTTACT GGG Intergenic
No off target data available for this crispr