ID: 978977444

View in Genome Browser
Species Human (GRCh38)
Location 4:114895591-114895613
Sequence GTTCTAAACAATTTAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1276
Summary {0: 1, 1: 0, 2: 32, 3: 331, 4: 912}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978977441_978977444 -6 Left 978977441 4:114895574-114895596 CCATTCCTTCTGAAACTGTTCTA 0: 1
1: 257
2: 9313
3: 3970
4: 2774
Right 978977444 4:114895591-114895613 GTTCTAAACAATTTAAAAGGAGG 0: 1
1: 0
2: 32
3: 331
4: 912
978977439_978977444 19 Left 978977439 4:114895549-114895571 CCAGAACTACAAAGAGGAACTGG 0: 1
1: 15
2: 412
3: 6496
4: 5818
Right 978977444 4:114895591-114895613 GTTCTAAACAATTTAAAAGGAGG 0: 1
1: 0
2: 32
3: 331
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978977444 Original CRISPR GTTCTAAACAATTTAAAAGG AGG Intronic
900775283 1:4579387-4579409 ATTCTAAACAATTGAAAAGGAGG - Intergenic
900817849 1:4863299-4863321 GTTCTAATCAATAGAAAAAGAGG - Intergenic
900922460 1:5682055-5682077 CTTCTAAACAACTTACCAGGTGG - Intergenic
901162030 1:7185571-7185593 GTTCTTACTAATTTCAAAGGGGG + Intronic
901914298 1:12486324-12486346 GTTCTAAAGAACTTAAAACTTGG + Intronic
904362191 1:29983494-29983516 GTTCAGATCAATGTAAAAGGAGG - Intergenic
905795027 1:40810989-40811011 GAACTGAACACTTTAAAAGGAGG - Intronic
906014345 1:42561061-42561083 ATTCCAAACAATTGAAAAGGAGG + Intronic
906954674 1:50363027-50363049 ATTCCAAACAATTGAAAAGGAGG + Intergenic
908090540 1:60680965-60680987 GTTCTAAAATATTAAAAAGTAGG - Intergenic
908723712 1:67152984-67153006 GCTCCAGACAATTGAAAAGGAGG - Intronic
908891770 1:68857236-68857258 ATTCCAAACAATTAAAAAGGAGG - Intergenic
908930212 1:69308956-69308978 ATTCCAAACAATTGAAAATGAGG - Intergenic
908950571 1:69557831-69557853 ATTCCAAACAATTGAAAAGGAGG - Intergenic
909137029 1:71814447-71814469 ATTCCAAAAAATTGAAAAGGAGG - Intronic
909178217 1:72386870-72386892 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
909297266 1:73966747-73966769 TTTCCAAACAATTGAAAAAGAGG - Intergenic
909374803 1:74927523-74927545 CTTCCAAAAAATTGAAAAGGAGG + Intergenic
909485765 1:76171940-76171962 ATTCCAAACAGTTGAAAAGGAGG + Intronic
909511920 1:76463151-76463173 GTTCTAAAAATTTTAATAGTGGG + Intronic
909518342 1:76537974-76537996 ATCTTAAACAATTGAAAAGGAGG + Intronic
909672731 1:78207034-78207056 ATTCCAAACAATAGAAAAGGAGG + Intergenic
909976782 1:82054816-82054838 ATTCCAAACAATTGAAATGGAGG - Intergenic
909992137 1:82236666-82236688 ATTCTAAACAATTGCAAAGGAGG - Intergenic
910016520 1:82531660-82531682 ATTCCAAACAAGTGAAAAGGAGG - Intergenic
910518091 1:88086271-88086293 ATTCCAAACAATTGAAAGGGAGG - Intergenic
910560602 1:88586264-88586286 ATCCCAAACAATTGAAAAGGAGG + Intergenic
910619041 1:89232810-89232832 ATTCCAAACAATTGAAAAGGTGG - Intergenic
910764524 1:90768036-90768058 ATTCCAAACAATTGAAAAGAGGG - Intergenic
911492179 1:98583968-98583990 ATTCCAAACAATTGAAAAGGAGG + Intergenic
911504332 1:98729864-98729886 ATTCTAAACAACTGAAAAGGAGG + Intronic
911508929 1:98787665-98787687 ATTCCAAACAATTGAAAAGAAGG + Intergenic
911626561 1:100131353-100131375 CTTCTAGAAAATTTAAAAGTAGG - Intronic
911800518 1:102132214-102132236 ATTCCAAACAATTGAAAAGGAGG + Intergenic
911874297 1:103139336-103139358 ATTCAAAAAAATTGAAAAGGAGG + Intergenic
912029442 1:105220874-105220896 ATTCCAAACAATATAAAAAGAGG - Intergenic
912032268 1:105263654-105263676 GTTCCAAACAATATAAAAAGAGG - Intergenic
912127127 1:106553406-106553428 ACTCCAAACAATTAAAAAGGAGG + Intergenic
912893579 1:113561221-113561243 ATTCCAAACAATTGAAAAGGAGG + Intronic
915639490 1:157212631-157212653 ATTCCAAACAATTGAAAAGGAGG - Intergenic
915692014 1:157699168-157699190 GATATAAAGAATTTAAATGGAGG + Intronic
915787354 1:158629028-158629050 GTTTCAAAAAATTTAAGAGGAGG + Intronic
915944277 1:160138377-160138399 GTTCTAATTAATTTTAAATGGGG + Intronic
915990926 1:160515462-160515484 ATTCCAAACAATTGAAAAGGAGG + Intronic
915995722 1:160561122-160561144 ATTCCAAAAAATTGAAAAGGAGG + Intronic
916124788 1:161559725-161559747 GATCTAGACAATTTAATCGGTGG - Intergenic
916134678 1:161641073-161641095 GATCTAGACAATTTAATTGGTGG - Intronic
916160586 1:161908809-161908831 ATTTTAAACAATTTAATTGGAGG + Intronic
916182859 1:162102482-162102504 ATTCCAAACAATTGAAAAGGAGG - Intronic
916343482 1:163761905-163761927 ATTCCAAACAATTGAAAAGGAGG + Intergenic
916905844 1:169281984-169282006 GTTCCAAACAATAGAAAAAGAGG - Intronic
917024712 1:170629811-170629833 ATTCCAAACAATTGAAAAGGAGG - Intergenic
917059411 1:171020219-171020241 ATTCCAAACAATTGAAAAGGAGG + Intronic
917060245 1:171029831-171029853 ATTCCAAACAATTGAAAAGGAGG - Intronic
917356095 1:174128003-174128025 ATTCCAAATAATTGAAAAGGAGG - Intergenic
917558832 1:176122712-176122734 GTAATAAACATTTTAAAAGGCGG - Intronic
917581897 1:176387308-176387330 ATTCTAAACAATTGAAAAGGAGG - Intergenic
917654181 1:177109688-177109710 CTTTTAAACAATGTGAAAGGAGG - Intronic
917682441 1:177381431-177381453 ATTCCAAACAATTGAAAAGGAGG - Intergenic
917890606 1:179434307-179434329 ATTCCAAACAATTGAAAAGGAGG + Intronic
917919269 1:179736506-179736528 GTTCTCAAAAAGTCAAAAGGTGG + Intergenic
918326420 1:183415337-183415359 TTTTAAAGCAATTTAAAAGGAGG + Intronic
918536459 1:185580358-185580380 ATTCCAAACAATTGAAAAGGAGG - Intergenic
918547925 1:185707082-185707104 GATGTAAACAAATTAAGAGGAGG - Intergenic
918558067 1:185829287-185829309 TTTCTAAAAAAAATAAAAGGGGG + Intronic
918614465 1:186528695-186528717 ATTCCAAACAATTGAAAAGGAGG - Intergenic
918786691 1:188772456-188772478 GTTCCAAACAATTGAAAACGGGG + Intergenic
918840586 1:189531899-189531921 GTTTTAAAAAATTAATAAGGGGG + Intergenic
918943517 1:191030777-191030799 ATTCTAAACAATTGCAAATGAGG + Intergenic
918989664 1:191682438-191682460 ATTCCAAACAATTGAAAAAGAGG + Intergenic
919093715 1:193004277-193004299 ATTCCAAATAATTGAAAAGGAGG + Intergenic
919215145 1:194543577-194543599 ATTCTAAACAATAGAAAAAGAGG - Intergenic
919410989 1:197242709-197242731 ATTCCAAACAATATAAAAAGAGG - Intergenic
919489840 1:198193414-198193436 ATTCCAAACAATTGAAAAGGAGG + Intronic
919551418 1:198993812-198993834 GTTCTAAAGAATTTACATTGTGG + Intergenic
919586296 1:199444688-199444710 ATTCCAAACAATTGAAAAGGAGG - Intergenic
920025885 1:202995643-202995665 GTTCCAAAAAATTTAAGAGGAGG + Intergenic
920210299 1:204323021-204323043 GCTCTAACCAATGTAAAAGCGGG - Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921144146 1:212336057-212336079 GTTCTTAACATTTTAGGAGGTGG + Intronic
921568351 1:216748404-216748426 ATTCCAAATAATTTAAAATGTGG + Intronic
921696081 1:218212743-218212765 GTTCAAAAAAATCTCAAAGGAGG - Intergenic
921698130 1:218235936-218235958 GTTCCAAACAATAGAAAAAGAGG + Intergenic
921750911 1:218793251-218793273 TTTCTAAACAATTTAGAAAAAGG - Intergenic
921881357 1:220258194-220258216 ATTCCAAAAAATTGAAAAGGAGG + Intronic
921919045 1:220645519-220645541 ATTCCAAACAATTGAAAAGGAGG + Intronic
923195142 1:231659016-231659038 ATTCCAAAAAATTGAAAAGGAGG - Intronic
923692955 1:236214188-236214210 CTCCTAAACATATTAAAAGGTGG + Intronic
923893848 1:238246845-238246867 GTTCCAGAAAATTTAAGAGGGGG + Intergenic
924313087 1:242766539-242766561 CTTCCAAATAATTGAAAAGGAGG + Intergenic
924412719 1:243822885-243822907 ATTCCCAACAATTGAAAAGGAGG + Intronic
924629948 1:245727621-245727643 ATTCCAAACAATTGAAAAGGAGG + Intergenic
924652601 1:245943587-245943609 ATTCCAAACAATTGAAAAAGAGG + Intronic
924718393 1:246600300-246600322 GTTAAAAACAATTTATAAGCTGG - Intronic
924867627 1:248002885-248002907 GTTCCAAACAATTGAAAAGGGGG - Intronic
924871855 1:248055806-248055828 TTTCCAAACAATTGAAAAGGAGG - Intronic
924893715 1:248313439-248313461 ATTCCAAAGAATTGAAAAGGAGG - Intergenic
924952783 1:248900192-248900214 ATTTCAAACAATTGAAAAGGAGG + Intergenic
1064541370 10:16408809-16408831 TTTCTACACATTTTAAAAAGAGG - Intergenic
1065246327 10:23762224-23762246 ATTCCAAACAATTGAAAAGAAGG + Intronic
1066151702 10:32628049-32628071 GTTCTAAAAAATTGAAAATGAGG - Intronic
1066584995 10:36923084-36923106 TTTGTAAATTATTTAAAAGGTGG - Intergenic
1067207299 10:44230054-44230076 ATTCCAGACAATTGAAAAGGAGG - Intergenic
1067256058 10:44643231-44643253 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1068186261 10:53590235-53590257 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1068232387 10:54185427-54185449 GATCTAAACTATTCAAAAGATGG + Intronic
1068380835 10:56252014-56252036 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1068435391 10:56984306-56984328 GTTCTAAACAATAGAAAAGGAGG - Intergenic
1068502477 10:57857534-57857556 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1068514720 10:58011421-58011443 TTTATAAAGCATTTAAAAGGTGG - Intergenic
1068718614 10:60216801-60216823 CTTCCAAACAATTAAAAAGGAGG - Intronic
1068786496 10:60981528-60981550 ATGCTAAACCATTTTAAAGGGGG - Intronic
1068835924 10:61553631-61553653 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
1069122473 10:64584295-64584317 ATTCCAAACAATTAAAAAGGAGG - Intergenic
1069250300 10:66258521-66258543 GCTCTAAACACTTTAAAAACAGG + Intronic
1069310700 10:67032437-67032459 GTTTTACAAAATTTAAGAGGAGG + Intronic
1069340878 10:67407023-67407045 ATTCCAAACAATTGAAAAGCAGG + Intronic
1069371458 10:67751928-67751950 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1070213523 10:74351033-74351055 ATTCCAAACAATTGAAAAAGAGG + Intronic
1070512600 10:77175204-77175226 GGTCTAATCATTTTAAAAGATGG + Intronic
1071059372 10:81551717-81551739 ATTCCAAACAATTGAAAAGTAGG + Intergenic
1071076901 10:81765735-81765757 ATTCCAAACAGTTGAAAAGGAGG - Intergenic
1071190410 10:83092780-83092802 ATTCCAAACAATAGAAAAGGAGG + Intergenic
1071213853 10:83375958-83375980 CTTCCAAAAAATTGAAAAGGAGG + Intergenic
1071317074 10:84412326-84412348 ATTCAAAAAAATTAAAAAGGAGG - Intronic
1071723763 10:88174794-88174816 ATTCCAAAAAATTTAAGAGGAGG - Intergenic
1071763483 10:88635059-88635081 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1072835172 10:98703387-98703409 ATTCCAAACAATTGAAAAGGAGG + Intronic
1072849705 10:98875633-98875655 CTTCCAAACAATTGAAAAGGAGG + Intronic
1072988273 10:100163837-100163859 GTTCTAAAGCCTTTAAAAGTAGG - Intronic
1073638678 10:105226592-105226614 ATTCCAAAAAATTTAAGAGGAGG - Intronic
1073822545 10:107281422-107281444 ATTCCAAACAATAGAAAAGGAGG - Intergenic
1073869779 10:107849963-107849985 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1074026254 10:109638619-109638641 ATAAAAAACAATTTAAAAGGAGG - Intergenic
1074682879 10:115926871-115926893 ATTCCAAACAATCGAAAAGGAGG + Intronic
1075860481 10:125671667-125671689 TTTCAGAACAATTGAAAAGGAGG - Intronic
1076412270 10:130260618-130260640 GATTTAAACAATTTTAAAAGTGG - Intergenic
1076933254 10:133548685-133548707 ATTCCAAACAATTGAAAAGGAGG + Intronic
1077855393 11:6119181-6119203 ATTCCAAACAAGTGAAAAGGAGG + Intergenic
1077857115 11:6138987-6139009 TTTCCAAAAAATTAAAAAGGAGG + Intergenic
1078162167 11:8850247-8850269 GTTCTTAATATTTTAAAAGTTGG + Intronic
1078254969 11:9650904-9650926 GTTCTAAACATTTTGAGCGGTGG + Intergenic
1078952836 11:16154446-16154468 GTTCCATACAATTTAAAATAAGG - Intronic
1078969934 11:16397399-16397421 ATTCTAATCATTTTAAAAAGTGG + Intronic
1079489370 11:20970423-20970445 GAGCTTAACAGTTTAAAAGGGGG + Intronic
1079623152 11:22580217-22580239 GCTATAAACACTTTAAAAGTGGG + Intergenic
1079690448 11:23410389-23410411 GTTGCAAACAATTGAAAAGGAGG - Intergenic
1079715251 11:23735513-23735535 ATTCTAAACAATAGAAAAAGAGG + Intergenic
1079752423 11:24215977-24215999 ACTCCAAACAATTGAAAAGGAGG + Intergenic
1079903146 11:26212739-26212761 ATTCTAAACAATAGAAAAAGAGG + Intergenic
1079966065 11:26981438-26981460 ATTCCAAACCATTAAAAAGGAGG - Intergenic
1080079671 11:28201417-28201439 ATTATAAACAATTGAAAAGTTGG - Intronic
1080164567 11:29221482-29221504 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1080215017 11:29830635-29830657 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1080500541 11:32866419-32866441 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1080513360 11:32997553-32997575 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1080782731 11:35445868-35445890 ATTCAAAACAATGGAAAAGGAGG - Intronic
1080916226 11:36663100-36663122 TTTGTAAACACTTAAAAAGGTGG - Intergenic
1081362976 11:42202716-42202738 CTTGTAAACATTTTAAGAGGGGG + Intergenic
1082875954 11:57988970-57988992 ATTCCAAACAATAGAAAAGGAGG - Intergenic
1082913240 11:58401148-58401170 TTTTTAAACAATGTAAAAGTTGG + Intergenic
1082938829 11:58682211-58682233 ATTCCAAACAATACAAAAGGAGG + Intronic
1082940633 11:58702026-58702048 GATGAAAACAATTTAAAGGGAGG - Intronic
1082994260 11:59237175-59237197 ATTCCAAACAATTGAAAAGAAGG + Intergenic
1083345618 11:61988898-61988920 ATTCCAAACAATTGAAATGGAGG + Intergenic
1084352015 11:68608957-68608979 GTTCCAAGCAATTTATAAGTAGG - Intronic
1084491809 11:69482951-69482973 GATGTAATCAAATTAAAAGGAGG - Intergenic
1084920784 11:72468045-72468067 ATTCTAAAAAATTTCAAAGATGG + Intergenic
1085066751 11:73502599-73502621 ATTCTAAACAACTGAAAAGGAGG + Intronic
1085215296 11:74825604-74825626 ATTCCAAAAAATTAAAAAGGAGG + Intronic
1085909213 11:80801406-80801428 ATTCCAAACAATTTAAAAGGAGG + Intergenic
1085928198 11:81047654-81047676 TTTCTAAACAATTAAAGACGTGG - Intergenic
1086123304 11:83323720-83323742 ATTCCAAAAAATCTAAAAGGAGG - Intergenic
1086132490 11:83415525-83415547 ATTCCAAACAATTGAAAAAGAGG - Intergenic
1086200926 11:84201482-84201504 GTTCCAAAAAACTGAAAAGGAGG - Intronic
1086514177 11:87592593-87592615 ATTCCAAATAATTGAAAAGGAGG + Intergenic
1086522717 11:87688863-87688885 ATTTCAAACAATTGAAAAGGAGG + Intergenic
1086574443 11:88322874-88322896 ATTCCAAACAATTGAAAAGGAGG + Intronic
1086789526 11:91018206-91018228 ATTCCAAACAATTGAAAAAGAGG - Intergenic
1087004131 11:93452375-93452397 GTTTTAAATAATTTTAAAGATGG + Intergenic
1087135814 11:94718188-94718210 GTGCAAAACAATTTACAAAGAGG - Intronic
1087194075 11:95287141-95287163 GTTCTAAGAAGTTTAAAAAGTGG - Intergenic
1087564199 11:99833536-99833558 GTTCTGAACAACTTTAAAGTAGG + Intronic
1087579509 11:100034249-100034271 ATACCAAACACTTTAAAAGGGGG + Intronic
1087719463 11:101645662-101645684 GTTCCAAACAGTTGAAAAGGAGG + Intronic
1087740054 11:101877084-101877106 ATTCCAAACAATTGAAATGGAGG - Intergenic
1088167253 11:106953556-106953578 ATTCTAAACAATTGAAAAGGAGG - Intronic
1088703032 11:112431393-112431415 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1088839670 11:113614573-113614595 CTTCAAAACAATTTAGAAGATGG + Intergenic
1089418467 11:118313558-118313580 GTTCTAAACATATTGAAGGGGGG + Intronic
1090165355 11:124540944-124540966 GCACTAAACAATATAAATGGGGG - Intergenic
1090308109 11:125708564-125708586 ATTACAAACAATTGAAAAGGAGG + Intergenic
1090690225 11:129173424-129173446 ACTCCAAACAATTAAAAAGGAGG + Intronic
1090847198 11:130540039-130540061 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1090919110 11:131192711-131192733 GTACTTAACACTTTGAAAGGGGG - Intergenic
1091866942 12:3847275-3847297 CTTCAAAAAAATTGAAAAGGAGG + Intronic
1092133734 12:6131566-6131588 GTTAAAAACAATTTCAAATGTGG + Intergenic
1092442854 12:8524233-8524255 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1092519278 12:9250812-9250834 ATTCTAAAAGATTGAAAAGGAGG + Intergenic
1092575584 12:9778904-9778926 ATGCCAAAAAATTTAAAAGGAGG - Intergenic
1093349272 12:18077536-18077558 GTTCTAAACAATTTTGAATCTGG + Intergenic
1093368451 12:18333970-18333992 GTTTTGAACATTTGAAAAGGTGG - Intronic
1093383020 12:18518271-18518293 ATTCCAAACAATTTAGAAGGTGG - Intronic
1093413324 12:18892758-18892780 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1093522832 12:20070365-20070387 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1093595562 12:20954704-20954726 ATTCTAAACAATAGAAAAGAGGG + Intergenic
1093666840 12:21824527-21824549 ATTCCAAACAATTGAAAAAGAGG - Intronic
1093677380 12:21959392-21959414 GTTTTAAACTTTTTAAAAGCTGG + Intergenic
1093891090 12:24522373-24522395 TTTCCAAAAAATTGAAAAGGAGG + Intergenic
1094055013 12:26260070-26260092 ATTCCAAACAATTGAAAAGGAGG + Intronic
1094206709 12:27848114-27848136 ATTCCAAACAATTAAAAAGGAGG - Intergenic
1094694669 12:32806248-32806270 GTTCCAAAAAATTGAAAAAGAGG - Intronic
1094776009 12:33728636-33728658 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1095130424 12:38535737-38535759 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1095320045 12:40816186-40816208 ATTCCAAACAATTGAAAAGGAGG - Intronic
1095510008 12:42940999-42941021 ATTCCAAACACTTGAAAAGGAGG - Intergenic
1095595641 12:43954737-43954759 ATTCCAAACAATTGAAAAGGAGG + Intronic
1095734135 12:45537762-45537784 GTTCTAAACATTTTACATAGAGG - Intergenic
1095857727 12:46879314-46879336 ATTCCAAACAATTGAAAAGGGGG + Intergenic
1096028883 12:48393866-48393888 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1097304141 12:58050984-58051006 GTTCCAAAAAATTGAAGAGGAGG + Intergenic
1097349950 12:58537711-58537733 GTTTTAAACTATTTTAAAGTCGG - Intergenic
1097410376 12:59245377-59245399 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1097422181 12:59393653-59393675 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
1097498786 12:60376895-60376917 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1097654064 12:62339921-62339943 ATTCCAAACAATTGAAAAAGAGG - Intronic
1097749280 12:63334180-63334202 ATTCCAAACAATTGAAAAGAGGG + Intergenic
1097824873 12:64165052-64165074 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1097881721 12:64692408-64692430 GGACTAAACACTTTACAAGGTGG + Intronic
1098047304 12:66413551-66413573 ATTCCAAACAATTGAAAAGGTGG + Intronic
1098193263 12:67973550-67973572 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1098637090 12:72797824-72797846 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1098645294 12:72893099-72893121 GTTCTGAACTTTATAAAAGGAGG + Intergenic
1098764594 12:74469912-74469934 ATTCCTAACAATTGAAAAGGAGG + Intergenic
1098830323 12:75353600-75353622 ATTCCAAACAACTGAAAAGGAGG + Intronic
1099022793 12:77426880-77426902 GTTCCAAACAATAGAAAAAGAGG - Intergenic
1099134078 12:78872199-78872221 TTACAAAACAATTTAAAAGCAGG - Intronic
1099486845 12:83239421-83239443 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1099502350 12:83429551-83429573 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1099624321 12:85049532-85049554 CTTATAAACAATAAAAAAGGAGG - Intronic
1099792952 12:87360244-87360266 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1099986180 12:89667365-89667387 GTGGTAAAGATTTTAAAAGGGGG - Intronic
1100099716 12:91088742-91088764 ATTCCAAACCATTGAAAAGGAGG - Intergenic
1100156708 12:91808070-91808092 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1100328083 12:93559812-93559834 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1100907025 12:99313372-99313394 ATTCCAAACAACTGAAAAGGAGG + Intronic
1100943759 12:99755450-99755472 ATTCCAAAAAATTGAAAAGGAGG + Intronic
1101070135 12:101065716-101065738 GTTCTAAAAAATGGAAGAGGAGG + Intronic
1101075545 12:101125923-101125945 ATTCCAAAAAATTAAAAAGGAGG - Intronic
1101511360 12:105395279-105395301 GTTCTAAATAATTAAAAATTAGG - Intronic
1101790428 12:107921537-107921559 ATTCCAAACAATTGAAATGGAGG + Intergenic
1102882410 12:116495876-116495898 GTTTTATAAAATTTACAAGGAGG - Intergenic
1103777166 12:123374719-123374741 GATCTAATCAAGTTAAAATGAGG + Intergenic
1104100328 12:125602068-125602090 ATTCCAAACAATTGAAAAGGAGG + Intronic
1104332408 12:127859377-127859399 GTACTAAACAATTTTCAAAGGGG - Intergenic
1105221928 13:18338367-18338389 GTACGAAACATTTTAAAAGTAGG - Intergenic
1105552283 13:21409144-21409166 ATTCTAAACAATAGAAAAAGGGG - Intronic
1105668146 13:22583418-22583440 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1105713940 13:23042534-23042556 TTCCTAAATAATTTAAGAGGAGG - Intergenic
1106285078 13:28311321-28311343 TTGCCAAACCATTTAAAAGGAGG - Intronic
1106646926 13:31645736-31645758 CTTCTAAAAAATTTAAGGGGAGG + Intergenic
1106889894 13:34233737-34233759 ATTCCAAACAATTGAAAAGAAGG - Intergenic
1107084710 13:36414038-36414060 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1107157171 13:37182398-37182420 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1107289485 13:38836480-38836502 ATTCCAAACAATAGAAAAGGAGG - Intronic
1107324076 13:39221725-39221747 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1107333809 13:39331831-39331853 ATTCTAAACAATAGAAAAAGAGG + Intergenic
1107354352 13:39550610-39550632 ATTCAAAACAATTTAAAAAGTGG - Intronic
1107578266 13:41751249-41751271 TTTTTAAAAAATTAAAAAGGGGG + Intronic
1107796628 13:44059829-44059851 TTTCTATACATTTTAATAGGAGG - Intergenic
1107965326 13:45592694-45592716 GTACTAAAAAAACTAAAAGGGGG + Intronic
1108130539 13:47294959-47294981 ATTCCAAACAATTGGAAAGGAGG - Intergenic
1108271558 13:48765416-48765438 CTTCTAAAGAATTGAAGAGGAGG - Intergenic
1108661366 13:52590247-52590269 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1108815324 13:54283861-54283883 ATTCCAAACAATTGAAAGGGAGG - Intergenic
1108858415 13:54823971-54823993 ATTCCAAACAATAGAAAAGGAGG + Intergenic
1109034537 13:57238488-57238510 TTTGAAAACAATTTACAAGGTGG - Intergenic
1109072132 13:57783785-57783807 ATTCTAAACAATGGAAAAGGAGG - Intergenic
1109144186 13:58757358-58757380 TTTCCAAAGAATTGAAAAGGAGG - Intergenic
1109155500 13:58904660-58904682 ATTCTAAAAAATTAAAGAGGAGG - Intergenic
1109227399 13:59713525-59713547 GTTCTGAACAATTTAAGCAGTGG + Intronic
1109426905 13:62176898-62176920 ATTCAAAACCATTAAAAAGGAGG + Intergenic
1109439490 13:62350488-62350510 ATTCAAAACAATTGAAAAGGAGG - Intergenic
1109502824 13:63259981-63260003 TGACTAAACATTTTAAAAGGTGG + Intergenic
1109531536 13:63654970-63654992 ATTCCTAACAATTGAAAAGGGGG - Intergenic
1109553494 13:63937586-63937608 ATTCCAAATAATTGAAAAGGAGG + Intergenic
1109927345 13:69161514-69161536 ATTCCAAACCATTGAAAAGGAGG + Intergenic
1109971228 13:69771412-69771434 CCTCTAAAAAATTTAAAATGAGG - Intronic
1110337621 13:74350166-74350188 CTTCCAAACAATTGAAAAGGAGG + Intergenic
1110402640 13:75111781-75111803 ATTCTGAACAATTGAAAAGGAGG + Intergenic
1110550392 13:76805357-76805379 GATGTAATCAAATTAAAAGGAGG - Intergenic
1110790103 13:79578377-79578399 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1110836596 13:80090644-80090666 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1110983879 13:81939092-81939114 ATTCCATACAATTGAAAAGGAGG - Intergenic
1111045495 13:82808657-82808679 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
1111064872 13:83076899-83076921 TTTCAAAACAATGTAATAGGAGG + Intergenic
1111159457 13:84374732-84374754 ATTTTTAACAATTTTAAAGGGGG - Intergenic
1111263180 13:85770987-85771009 GTTCTCAGCATTTTAAAAAGTGG - Intergenic
1111286805 13:86104531-86104553 GTTCCAAACAATTGAAAAGGAGG - Intergenic
1111332514 13:86778493-86778515 ATTCCAAACAATTAAAATGGAGG - Intergenic
1112102537 13:96205432-96205454 ATTCCAAACAATTGAAAAGAAGG + Intronic
1113005602 13:105698564-105698586 TTTCTAAACACATTAATAGGTGG + Intergenic
1113238370 13:108308665-108308687 GTTCTAAAAAGTTTAAAATTAGG - Intergenic
1113528037 13:110997153-110997175 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1113556188 13:111237287-111237309 GTTGTGAACAATTTAAAAAATGG + Intronic
1114412745 14:22516135-22516157 GTTCTAACCTAATTATAAGGAGG + Intergenic
1114706297 14:24730106-24730128 ATTTCAAACAATTGAAAAGGAGG + Intergenic
1114762211 14:25328856-25328878 ATTCCAAACAATATAAAAAGAGG + Intergenic
1114771820 14:25435839-25435861 ATTCCAAAAAATTAAAAAGGAGG - Intergenic
1114971370 14:28033550-28033572 ATTCCAAGCAATTGAAAAGGAGG - Intergenic
1115295039 14:31816071-31816093 ATTCCAAACAATTGAAAAAGAGG - Intronic
1115690633 14:35840405-35840427 ATTCTAAACAATAGAAAAAGAGG - Intronic
1115839987 14:37459624-37459646 GTTCTAAAAAATTGAAGAGGAGG + Intronic
1115866799 14:37756885-37756907 GTTCCAAACAATAGAAAAAGAGG - Intronic
1115927533 14:38452331-38452353 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1115928514 14:38464605-38464627 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1116193249 14:41686995-41687017 ATTCCAAACAATTGGAAAGGAGG - Intronic
1116428995 14:44824058-44824080 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1116493385 14:45532844-45532866 GTTCCAAAAAATTAAAAAGGAGG - Intergenic
1116498464 14:45591269-45591291 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1116513342 14:45774294-45774316 TATCTAAAAAATTTCAAAGGAGG - Intergenic
1116560599 14:46374119-46374141 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1116977837 14:51135393-51135415 ATTCCAAACAGTTAAAAAGGAGG + Intergenic
1117326336 14:54672244-54672266 GCTCGAAAAAATTTAAAAGAGGG - Intronic
1117430452 14:55654215-55654237 GTTAAAAGCAATTTTAAAGGGGG - Intronic
1117466165 14:55996585-55996607 GTTCTAAACAATAGAAAAAGAGG - Intergenic
1117544881 14:56784944-56784966 GTTCAAATCAAGTTACAAGGTGG - Intergenic
1117619955 14:57575588-57575610 GGTTTAAACATTTTAAATGGAGG - Intronic
1117751366 14:58927293-58927315 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1117857266 14:60048743-60048765 ATTCCAAAAAATTGAAAAGGAGG + Intronic
1118528741 14:66676852-66676874 CTTCCAAAAAATTAAAAAGGTGG - Intronic
1118531016 14:66705270-66705292 ATTCCAAACAGTTGAAAAGGAGG + Intronic
1118557663 14:67043760-67043782 ATTCTAAACAATAGAAAAAGAGG - Intronic
1118558571 14:67053568-67053590 ATTCTAAACAACTGAAAAGGAGG + Intronic
1118624274 14:67643304-67643326 ATTCTACAGAATTTCAAAGGAGG + Intronic
1118754344 14:68828059-68828081 GTTTTTAAAAATTAAAAAGGAGG + Intergenic
1119499010 14:75106895-75106917 ATATTAAACAATTTAAAAAGTGG + Intronic
1119549575 14:75498513-75498535 ATGCTAAAAAATTTAACAGGGGG - Intergenic
1120058794 14:79957158-79957180 GTTCCAAAAAATTGAAAAGGAGG + Intergenic
1120114784 14:80602469-80602491 TGTCTAAATAAATTAAAAGGAGG + Intronic
1120378333 14:83739894-83739916 GTTAATAACAATTTAAAATGAGG - Intergenic
1120449732 14:84652163-84652185 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1121003486 14:90470224-90470246 ATTCCAAACAATGGAAAAGGAGG - Intergenic
1121707122 14:96005544-96005566 ATTCTAAGCAATTGAAAAGGAGG + Intergenic
1122612687 14:102996388-102996410 GAGAAAAACAATTTAAAAGGTGG + Intronic
1124046209 15:26152551-26152573 ATTACAAACAATTGAAAAGGAGG - Intergenic
1124224555 15:27881399-27881421 ATTCCAAACAATTGAAAAGGAGG - Intronic
1124717494 15:32078756-32078778 ATTCCAAACAATTAAAAAGGAGG + Intronic
1125202407 15:37111472-37111494 GGTCTGAAGAATTTAAAAAGAGG - Intergenic
1125286532 15:38099048-38099070 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1126117278 15:45219743-45219765 ATTCTTAAGAATGTAAAAGGCGG - Intergenic
1126279638 15:46929858-46929880 GTTCCAAAAAATTGAAGAGGAGG - Intergenic
1126284244 15:46993299-46993321 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1126552670 15:49950195-49950217 ATTTCAAACAATTGAAAAGGAGG - Intronic
1126784619 15:52167282-52167304 ATTCTAAACAATTGAAAAGGAGG + Intronic
1126876918 15:53053211-53053233 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1126897737 15:53277623-53277645 ATTCTGAAAAATTGAAAAGGTGG + Intergenic
1126948810 15:53855827-53855849 GTTCCAAAAGATTGAAAAGGAGG - Intergenic
1127024218 15:54784937-54784959 GCTCCAAACAATTGAAAAGGTGG + Intergenic
1127065964 15:55238834-55238856 GTTCTGATCAACTTAAAAAGAGG + Intronic
1127100249 15:55557074-55557096 GTTCCAAAGAAATGAAAAGGAGG + Intronic
1127105123 15:55605526-55605548 ATTCCAAACTATTGAAAAGGAGG + Intergenic
1127204353 15:56697483-56697505 GTTTTAAAAAATGTAACAGGTGG - Intronic
1127209042 15:56752552-56752574 CTTCTAAAAAATTAAACAGGAGG - Intronic
1127616662 15:60692905-60692927 ATTTTAAACAATTGAAAAAGAGG + Intronic
1127687361 15:61361658-61361680 ATTATAAACAATTGAAAAGGAGG - Intergenic
1128857627 15:71032467-71032489 ATTCCAAACAATTGAAAAGGAGG + Intronic
1129127108 15:73451586-73451608 ATTCTAAACAATATAAAAAGAGG + Intronic
1130796031 15:87210408-87210430 GATCTCAACATTTTAAAAGCAGG + Intergenic
1130848637 15:87771464-87771486 ATTCCAAACAACTAAAAAGGAGG + Intergenic
1131942373 15:97581652-97581674 ATTCCAAACAATTGAAAGGGAGG - Intergenic
1132133087 15:99303423-99303445 GATATAAAAAATTTAAAATGTGG + Intronic
1132254300 15:100361920-100361942 ATTTTAAACAATAGAAAAGGAGG + Intergenic
1132894590 16:2222720-2222742 ATTTTAAAAAATTTAAAAAGTGG + Intergenic
1133991568 16:10711333-10711355 ATTGTAAACAATATCAAAGGGGG + Intergenic
1135341626 16:21653377-21653399 TTTCTCAACACATTAAAAGGGGG - Intronic
1136645701 16:31612508-31612530 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1136659532 16:31744659-31744681 ATTCCAAACAATTGAAAAGGAGG - Intronic
1137065157 16:35832935-35832957 ATTCCAAACAATTTAAAAGGAGG - Intergenic
1138227908 16:55314363-55314385 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1138653863 16:58478736-58478758 TTTCAAAATAAGTTAAAAGGGGG + Intronic
1139301784 16:65951209-65951231 ATTTTAAGCAATTTAATAGGTGG - Intergenic
1140954918 16:79854077-79854099 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1141368458 16:83465560-83465582 GCTCTTATCAATTAAAAAGGCGG - Intronic
1141415238 16:83866279-83866301 ATTCCAAAGAATTGAAAAGGAGG - Intergenic
1142916108 17:3139866-3139888 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1143071347 17:4296557-4296579 GTACTAAAACCTTTAAAAGGAGG - Intronic
1143831506 17:9655559-9655581 GTGCTACACAATTTAACAGAAGG + Intronic
1144432264 17:15204460-15204482 ATTCGAAACAATTGAAAGGGAGG + Intergenic
1146766520 17:35527315-35527337 ATTCTAAACAATAGAAAAAGAGG + Intronic
1147049651 17:37783218-37783240 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1149229390 17:54515671-54515693 ATTCCAAACAATTGAAAAGAAGG - Intergenic
1149241841 17:54660065-54660087 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1149312916 17:55413023-55413045 GTTCTAAAAAAATTAATATGGGG + Intronic
1150196115 17:63301314-63301336 ATTCCAAACAACTGAAAAGGAGG - Intronic
1150963972 17:69946740-69946762 GTTCAAAAAAATCTAAATGGTGG - Intergenic
1151235513 17:72717178-72717200 ATTTTAAAAAATTTAAAAAGAGG + Intronic
1152482704 17:80565734-80565756 TTTGCAAACATTTTAAAAGGTGG + Intronic
1153349648 18:4064796-4064818 GTTCCAAAAAATTAATAAGGAGG + Intronic
1153360804 18:4194470-4194492 GTTCTGAACAATTTCAAAATTGG - Intronic
1153460326 18:5325811-5325833 ATTCTGAAAAATTGAAAAGGAGG + Intergenic
1154493380 18:14938279-14938301 GTTTTAGAAAATTTAAAAAGTGG + Intergenic
1155069246 18:22298865-22298887 GTTTTAAATCATTTAAAAAGTGG + Intergenic
1155432508 18:25775357-25775379 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1156084910 18:33386311-33386333 ATTCCAAACAATTGAAAAGGAGG + Intronic
1156313684 18:35948364-35948386 GTTTTAAAAAATTTGGAAGGGGG - Intergenic
1156562025 18:38136054-38136076 ATTCTAAACAATTGAGGAGGAGG + Intergenic
1156645515 18:39156714-39156736 TTTCTAAACAATATAAAAAATGG + Intergenic
1156664968 18:39393687-39393709 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1156669078 18:39445925-39445947 ATTCTAAACAATAGAAAAAGAGG + Intergenic
1156683896 18:39621364-39621386 TTGCTAAATAATTTAAAATGTGG + Intergenic
1156695176 18:39757267-39757289 ATTCCAAACAATTGAAAAGAAGG + Intergenic
1156699741 18:39811514-39811536 ATACTAAACAATTGAAAAGGAGG - Intergenic
1157016630 18:43722659-43722681 ATTCCAAACAATTGAAAGGGAGG + Intergenic
1157055742 18:44226403-44226425 GTTCCCAAAAATTGAAAAGGAGG - Intergenic
1157062084 18:44303453-44303475 GTTCTAATCAATAGAAAAGGAGG + Intergenic
1157824240 18:50798056-50798078 GTTCAAGACAATTTAAAACACGG - Intronic
1158023133 18:52867415-52867437 ATTCCAAACAATTGAAAAAGAGG - Intronic
1158308349 18:56131441-56131463 GTTCCAAACAATAGAAAAAGAGG + Intergenic
1158692583 18:59673978-59674000 GTTCCAAACAATAGAAAAAGAGG - Intronic
1158728729 18:59999934-59999956 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1158765312 18:60443860-60443882 ATTCCAAACAATTAAAAAGGAGG - Intergenic
1159076992 18:63691662-63691684 ATTCCAAACAATTGAAAAGGAGG + Intronic
1159239176 18:65719105-65719127 TTTCTATAAAATTGAAAAGGAGG + Intergenic
1159387582 18:67745599-67745621 ATTCTAAACAATTGAAAAAGAGG + Intergenic
1159392549 18:67812087-67812109 GTTTTAATTAATTTAAAATGTGG - Intergenic
1160273735 18:77411068-77411090 CTTATAAAAAATTTAAAAAGTGG - Intergenic
1161033020 19:2068125-2068147 GTTCTTCACATTTTAACAGGAGG + Intergenic
1164197331 19:22981484-22981506 ATTCCAAACAATACAAAAGGAGG + Intronic
1164264969 19:23606828-23606850 ATTCCAAAAAATTAAAAAGGAGG - Intronic
1164600077 19:29556013-29556035 ATTCCAAACAATTGAAAAGGAGG + Intronic
1164663153 19:29997105-29997127 CTTCTAAACAATGAAAAGGGAGG - Intronic
1165586429 19:36920320-36920342 GTTTTAAAAAATTGAAAAGCTGG + Intronic
1166236650 19:41461770-41461792 ATTAGAAACAATATAAAAGGGGG + Intergenic
1166585483 19:43943658-43943680 ATTTTAAAGAATTTAAAAGGGGG + Intergenic
1166588482 19:43972857-43972879 ATTCCAAACAATTGAAAAGAAGG + Intronic
1166904455 19:46097051-46097073 ATTCCAAACAATTGAAAAGGAGG - Intergenic
925006894 2:450513-450535 GTTTTCAATAATTTCAAAGGCGG + Intergenic
925441993 2:3895980-3896002 ATTCTGAACAATTAAAAAGGAGG - Intergenic
925447188 2:3937450-3937472 ATTCCAAACAATTGAAAAAGAGG - Intergenic
925566508 2:5260242-5260264 ATTCTAAACAATAGAAAAAGAGG + Intergenic
926454194 2:13043901-13043923 ATTCCAATCAATTGAAAAGGAGG + Intergenic
926650930 2:15344617-15344639 ATTCCAAACAACTGAAAAGGAGG + Intronic
927568109 2:24132363-24132385 ATTTCAAACAATTGAAAAGGAGG - Intronic
928083445 2:28329787-28329809 ATTCCAAACAATTGAAAAGGAGG + Intronic
928386766 2:30875967-30875989 ATTCCAAACAATCGAAAAGGAGG + Intergenic
928473682 2:31601521-31601543 GTTCCAAAAAATTGAAAAAGAGG + Intergenic
928850341 2:35737862-35737884 ATTCCAAACAGTTGAAAAGGAGG + Intergenic
928880493 2:36091991-36092013 ATTCTAAACAACTGAAAAAGAGG + Intergenic
928908283 2:36391426-36391448 GTTCTAAAAAAATCAAAAGTGGG - Intronic
929280142 2:40069186-40069208 ATTCTAAGAAATTGAAAAGGAGG - Intergenic
929696858 2:44124833-44124855 GTTCTAAACCATCTAAAAGATGG + Intergenic
930241186 2:48937336-48937358 GTTCTAAATAATTTAGATGAAGG + Intergenic
930350973 2:50253950-50253972 ATTCCAAACAATTGAAAAGGAGG - Intronic
930951705 2:57150488-57150510 ATTCCAAACAATTGAAAAGGAGG + Intergenic
931023636 2:58081490-58081512 CATCTAAACAATTTAATAGATGG - Intronic
931074292 2:58692106-58692128 ATTCCAAACAATTGAAAAAGAGG + Intergenic
931560808 2:63558887-63558909 ATTCCAAACAACTGAAAAGGAGG + Intronic
931589479 2:63866401-63866423 GTTCTAAATAATTAAATAAGTGG + Intronic
932013870 2:68004435-68004457 ATTCCAAACAATTGAAAAGGAGG + Intergenic
932045731 2:68347585-68347607 ATGCCAAACAATTGAAAAGGAGG + Intergenic
932379972 2:71273529-71273551 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
932941681 2:76174062-76174084 ATTCCAAACAATTGAGAAGGAGG - Intergenic
933013755 2:77096764-77096786 TTTGTAATCAATTCAAAAGGAGG + Intronic
933052366 2:77615548-77615570 ATTTCAAACAATTGAAAAGGAGG + Intergenic
933132480 2:78689902-78689924 TTTCCAAACAATTGAAAAGGAGG + Intergenic
933395129 2:81721771-81721793 TTACTTAAAAATTTAAAAGGTGG + Intergenic
933534472 2:83554847-83554869 ATTCCAAACAATTGAAAAGGAGG - Intergenic
933606088 2:84385499-84385521 ATTCCAAACAATTAAAAAGGAGG - Intergenic
934620555 2:95801083-95801105 TTCCAAAACAATTGAAAAGGAGG - Intergenic
934812885 2:97298645-97298667 TTCCAAAACAATTGAAAAGGAGG + Intergenic
934824810 2:97409835-97409857 TTCCAAAACAATTGAAAAGGAGG - Intergenic
935231298 2:101099465-101099487 ATTCCAAACAATTGAAAAGGAGG + Intronic
935489013 2:103694542-103694564 ATTCCAAACAATTGAAAAGGTGG - Intergenic
935532919 2:104257139-104257161 ATTCTGAAAAATATAAAAGGAGG + Intergenic
935799242 2:106676607-106676629 ATTCCAAACAATTGAAAAGGAGG - Intergenic
935852436 2:107237016-107237038 ATTCCAAACAATTGAAAAGGAGG + Intergenic
935952326 2:108341851-108341873 GTTCCAAAGAGTTGAAAAGGAGG - Intergenic
936139949 2:109930730-109930752 ATTCCAAACAATTGAAAAGGAGG - Intergenic
936172391 2:110187625-110187647 ATTCCAAACAACTGAAAAGGAGG + Intronic
936176638 2:110228675-110228697 ATTCCAAACAATTGAAAAGGAGG - Intergenic
936204747 2:110440756-110440778 ATTCCAAACAATTGAAAAGGAGG + Intronic
937148181 2:119665608-119665630 ATTCCAAACAATTGAAAAGGAGG + Intergenic
937604640 2:123783810-123783832 GTCCTTATCTATTTAAAAGGAGG + Intergenic
937722359 2:125117030-125117052 GTTCCAAAAAATAGAAAAGGAGG + Intergenic
937893615 2:126960154-126960176 ATTCCAAACAATTGAAAAGGAGG - Intergenic
937978336 2:127595009-127595031 ATTCCAAACAATTGAAAAGCAGG - Intronic
938136505 2:128762742-128762764 ATTCCAAACAATTGAAAAGGAGG - Intergenic
938567785 2:132535597-132535619 ATTCCAAACAACTGAAAAGGAGG - Intronic
938996106 2:136679978-136680000 ATTCCAAACAATTGAAAAGGAGG + Intergenic
939022610 2:136977003-136977025 ATTTCAAACAATTTAAAAGGAGG - Intronic
939248169 2:139651763-139651785 ATTCTAAACAATAGAAAAAGAGG + Intergenic
939370104 2:141287912-141287934 GTTTCATATAATTTAAAAGGAGG - Intronic
939391468 2:141574050-141574072 ATTCCAAACAATTGAAAAGGGGG + Intronic
939487307 2:142830755-142830777 CTTCCAAACAGTTGAAAAGGAGG - Intergenic
939937091 2:148305940-148305962 GTAATAAAAAATTAAAAAGGGGG - Intronic
939937428 2:148310181-148310203 ATTCCAAACAATAGAAAAGGAGG - Intronic
940057011 2:149524337-149524359 ATTCCAAATAATTGAAAAGGAGG - Intergenic
940094664 2:149960939-149960961 ATTCCAAACAATTGAAAAGGAGG - Intergenic
940114752 2:150195772-150195794 ATTCCAAACAATTGAAAAAGAGG + Intergenic
940154104 2:150635474-150635496 GTTCTATAGAATTTTAGAGGTGG - Intergenic
940411084 2:153363843-153363865 ATTCCAAACAACTGAAAAGGAGG + Intergenic
940417762 2:153442482-153442504 ATTCTAAACAATAGAAAAAGAGG - Intergenic
940745453 2:157562576-157562598 ATTCCAAACAATTGAAAAGGAGG + Intronic
940832899 2:158488093-158488115 GTTATAAACAATTTAGTAGGTGG - Intronic
941114693 2:161459033-161459055 ATTCTAAACAATAGAAAAAGAGG - Intronic
941135877 2:161717828-161717850 ATTCCAAACAATTGGAAAGGAGG - Intronic
941496865 2:166215850-166215872 CTTCCAAAAAATTGAAAAGGAGG + Intronic
941694148 2:168533295-168533317 GTTCCAAACAATAGAAAAAGAGG - Intronic
941973630 2:171379853-171379875 ATTACAAACAATTGAAAAGGAGG + Intronic
942350201 2:175044565-175044587 ATTCCAAACAACTGAAAAGGAGG - Intergenic
942434949 2:175961161-175961183 ATTCCAAACAATACAAAAGGAGG + Intronic
942504185 2:176624343-176624365 ATTCCAAACAATAGAAAAGGAGG - Intergenic
943095197 2:183420044-183420066 ATTCTAAACAATAGAAAAAGAGG + Intergenic
943158696 2:184218107-184218129 ATTCCAAACAATGGAAAAGGAGG - Intergenic
943296413 2:186145943-186145965 ATTCCAAACAATTGAAAAGAAGG + Intergenic
943350271 2:186788934-186788956 ATTCCAAACAATTGAAAAGGAGG + Intergenic
943403126 2:187441720-187441742 TTTCTAAACAAATTAAAATCTGG - Intronic
943433720 2:187836136-187836158 GGTCTAAATAATGTAAAAAGGGG - Intergenic
943951153 2:194133508-194133530 GTTCTAGACAGTTAAAATGGGGG + Intergenic
943969198 2:194381531-194381553 ATTTTAAACATTTTATAAGGGGG - Intergenic
943989726 2:194672389-194672411 ATTCTGAACTATTTAAAATGTGG - Intergenic
944035811 2:195293382-195293404 ATTCCAAACAATTGAAAAGAAGG + Intergenic
944385423 2:199158409-199158431 ATTCCAAACAATTGAAAAGTAGG + Intergenic
944439085 2:199723920-199723942 ATTCCAAACAATTGAAAAGGAGG - Intergenic
945110913 2:206358581-206358603 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
945388274 2:209230468-209230490 ATTCCAAACAATTAAAAAAGGGG - Intergenic
945434247 2:209800101-209800123 ATTCCAAACAATTAAAAAGGAGG - Intronic
945439423 2:209861570-209861592 ATTCCAAACAATTGAGAAGGAGG - Intronic
945780078 2:214158813-214158835 TTTGTAAACAATTTCCAAGGAGG - Intronic
946546612 2:220750880-220750902 GTTCCAAACAATTGAAAAGGAGG - Intergenic
946913358 2:224488717-224488739 ATTCCAAACAATATAAAAAGAGG + Intronic
946974086 2:225128620-225128642 ATTCCAAACAATTGAAAAGAAGG + Intergenic
947033827 2:225828185-225828207 ATTCCAAACAATTGAAAAGGAGG + Intergenic
947449290 2:230191737-230191759 ATTCCAAACAATTGAAAAGGAGG + Intronic
948538050 2:238661888-238661910 GTTCTAAAGACTAGAAAAGGAGG - Intergenic
1168817584 20:750716-750738 CTTCCAAAAAATTTAAGAGGAGG + Intergenic
1169695342 20:8381479-8381501 ATTCCAAACAAATGAAAAGGGGG - Intronic
1169978862 20:11361085-11361107 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1170076506 20:12425209-12425231 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1170469959 20:16658887-16658909 ATTCCAAACAATTGAAAAGCAGG - Intergenic
1170492452 20:16892215-16892237 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1170496915 20:16934225-16934247 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1170730314 20:18969046-18969068 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1170766720 20:19295893-19295915 ATTCCAAACAATTGAGAAGGAGG - Intronic
1170826934 20:19804734-19804756 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1171110577 20:22477649-22477671 ATTCAAAAAAATTGAAAAGGAGG + Intergenic
1171478252 20:25430953-25430975 TTTCTAAAAAATATAAAAGGAGG - Intronic
1171847808 20:30288382-30288404 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1172205566 20:33160619-33160641 GTTCTTAACAATGGAAAAGGTGG - Intergenic
1173149715 20:40556324-40556346 TTTCCAAACAATTGAAAAGGAGG + Intergenic
1173412098 20:42821018-42821040 ATTCCAAACAATTGAAAAGGAGG + Intronic
1174719088 20:52791725-52791747 GTTCTATATAATTAAAAAGTGGG + Intergenic
1174865976 20:54136023-54136045 GATGTAATCAAGTTAAAAGGAGG - Intergenic
1175555322 20:59849818-59849840 TTTCTAAAAAAATTTAAAGGGGG + Intergenic
1175591683 20:60197951-60197973 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1176344135 21:5725590-5725612 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1176350949 21:5846174-5846196 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1176500692 21:7598866-7598888 ATTCTAAACAATTGAAAAGGAGG + Intergenic
1176538456 21:8123659-8123681 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1176585820 21:8584347-8584369 ATTCTAAAAAAATTAAAAGAGGG - Intergenic
1176668919 21:9713777-9713799 GTTGTTAACAAGTTAAAAGAAGG - Intergenic
1176730365 21:10489207-10489229 GTACGAAACATTTTAAAAGTAGG - Intergenic
1177304510 21:19295771-19295793 ATTCCAAACAACTGAAAAGGCGG + Intergenic
1177388484 21:20436842-20436864 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1177463561 21:21444368-21444390 ATTCCAAACAATTGAAACGGAGG - Intronic
1177556347 21:22694010-22694032 ATTCAAAACAATTAGAAAGGAGG - Intergenic
1177956259 21:27602949-27602971 ATTCCAAGCAATTGAAAAGGGGG - Intergenic
1178033844 21:28558572-28558594 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1178411843 21:32370231-32370253 GTTTTACTCAATTTATAAGGGGG - Intronic
1179929964 21:44561437-44561459 ATTCCAAACAACTGAAAAGGAGG + Intronic
1179945874 21:44675030-44675052 GTTCCAAAAAATTGAAGAGGAGG + Intronic
1180250050 21:46578993-46579015 ATTCCAAACAATAGAAAAGGAGG - Intergenic
1181600816 22:23950972-23950994 GATCTCAACACTTTAGAAGGAGG - Intergenic
1181607696 22:23990354-23990376 GATCTCAACACTTTAGAAGGAGG + Intergenic
1182195339 22:28510135-28510157 ATTCCAAAAAATTAAAAAGGAGG + Intronic
1182202983 22:28592348-28592370 TTTCTAAAAAATTTAAAATTAGG + Intronic
1182487122 22:30646284-30646306 GTTGTAAACATTTTAAAAGACGG - Intronic
1182938613 22:34252008-34252030 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1183140262 22:35931235-35931257 GTTCTAGACAACCTAACAGGGGG + Intronic
1184055047 22:42041011-42041033 GTTAAAAACAATTTAATAGTAGG - Intronic
1184789327 22:46689632-46689654 CTCCTAAATAATTCAAAAGGTGG - Intronic
1184809389 22:46819773-46819795 ATTCCAAACAATTGAAAAAGAGG - Intronic
1185075766 22:48681328-48681350 TTTTTAAACAATTTGAAATGAGG - Intronic
1203243403 22_KI270733v1_random:40015-40037 ATGCCAAACAATTGAAAAGGAGG - Intergenic
949356635 3:3187801-3187823 ATTATAAAAAAATTAAAAGGAGG + Intergenic
949466251 3:4347138-4347160 ATTCCAAACAATTGAAAAGAAGG + Intronic
949467410 3:4357988-4358010 GTTCAAAAAAAAGTAAAAGGTGG + Intronic
950126530 3:10513340-10513362 GTTCTCAATGAATTAAAAGGAGG + Intronic
950323373 3:12079838-12079860 ATTCCAAACAATTGAAAAGGAGG - Intronic
950822558 3:15776765-15776787 ATTTTAAAAAAGTTAAAAGGAGG + Intronic
950833346 3:15896836-15896858 CTTCTAACCAATATAAAATGTGG + Intergenic
951073080 3:18355147-18355169 TTCCAAAAAAATTTAAAAGGGGG + Intronic
951261093 3:20509920-20509942 GTTCTAAAGAATTGTGAAGGAGG - Intergenic
951859292 3:27233724-27233746 ATTCCAAAAAATTTTAAAGGAGG + Intronic
952503400 3:33985719-33985741 ATTCCAAATAATTGAAAAGGAGG - Intergenic
952574836 3:34762094-34762116 ATTCCAAACAATTAAAAAGGAGG + Intergenic
952607659 3:35169494-35169516 ATTCCAAACAATTGATAAGGAGG - Intergenic
952679180 3:36071551-36071573 ATTCCAAACAATTGAAAAGGAGG - Intergenic
952721314 3:36536004-36536026 ATTCCAAACAATTGAAAAGGAGG - Intronic
953053245 3:39365429-39365451 ATTTTAAAAAATTAAAAAGGAGG + Intergenic
953245951 3:41192708-41192730 ATTCTGAACAATTTAAAAAAGGG - Intergenic
953269571 3:41427375-41427397 ATTCCAAACAATTGAAAAGAAGG + Intronic
953478512 3:43227633-43227655 ATTCCAAACAATTGAAAAGGAGG + Intergenic
953543899 3:43847144-43847166 ATTCCAAACAATTGAAAAGGAGG + Intergenic
955303573 3:57807806-57807828 ATTCCAAACAATTGAAAAGGAGG - Intronic
955435308 3:58893670-58893692 ATTCCAAACAATTGAAAAGGAGG - Intronic
955632992 3:60994942-60994964 TTTCTAAACATTTAAAAAGCTGG - Intronic
955831795 3:63012599-63012621 ATTCCAAACAATTGAAAAGGAGG - Intergenic
956014663 3:64869062-64869084 GTTCTAATAAATTTAGAAGAAGG - Intergenic
956279299 3:67539595-67539617 ATTCCAAACAATAGAAAAGGAGG - Intronic
956386167 3:68721931-68721953 ATTCTACAAAATTGAAAAGGAGG - Intergenic
957395051 3:79625813-79625835 ATTCTAAACAATTGAAAAGGGGG + Intronic
957629759 3:82703952-82703974 ATTCCAAACAATTGAAAAGGAGG - Intergenic
957639253 3:82830210-82830232 GTTCTAATAAATTGAAAAGGAGG - Intergenic
957689649 3:83551342-83551364 ATTCCAAACAATTGAAAAGGAGG - Intergenic
957726665 3:84074702-84074724 GTTCTTAAGCATTAAAAAGGAGG + Intergenic
957727967 3:84092341-84092363 TTCATAAACAATTTAAAAGCCGG + Intergenic
957754053 3:84464775-84464797 TCTCAAAACAATTTAAAAAGGGG - Intergenic
957872192 3:86103511-86103533 GTTCCAAAGAATTGAAAAGGAGG - Intergenic
958009754 3:87862034-87862056 ATTTTAAACAAATTATAAGGAGG + Intergenic
958072932 3:88637900-88637922 ATTCCAAACATTTGAAAAGGAGG - Intergenic
958523597 3:95223721-95223743 ATTCCAAACAATTGAAAAGTAGG - Intergenic
958649851 3:96925182-96925204 ATTCCAAAAAATTAAAAAGGAGG - Intronic
958656147 3:97006153-97006175 ATTCCAAACAATTGAAAAGGAGG - Intronic
958775722 3:98480525-98480547 ATTCTAAACAATAGAAAAAGAGG - Intergenic
958815497 3:98910054-98910076 ATTCCAAAGAATTGAAAAGGAGG + Intergenic
958972363 3:100626045-100626067 ATTCCAAACAATTGAAAAAGAGG - Intronic
959052114 3:101534426-101534448 GCTCTAAACAATTTTTTAGGGGG - Intergenic
959205505 3:103301719-103301741 ATTTCAAACAATTGAAAAGGAGG - Intergenic
959264079 3:104115761-104115783 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
959453032 3:106526347-106526369 ATTCCAAACAATTGAAAAGGAGG + Intergenic
959694814 3:109237954-109237976 ATTCCAAACAATTGAAAAGAAGG + Intergenic
959898324 3:111630613-111630635 ATTCTAAAAAATTTAAAAGAAGG + Intronic
960008653 3:112809044-112809066 GTTCTAAACAGCTGAAAAGATGG - Intronic
960276897 3:115738911-115738933 ATTCCAAACAATTGGAAAGGAGG - Intergenic
960679774 3:120235538-120235560 ATTTCAAACAATTGAAAAGGAGG - Intronic
960866741 3:122209333-122209355 ATTCCAAACAATTGAAAAGGAGG + Intronic
961644506 3:128385409-128385431 GTTGTCAACATTTTAAAATGTGG - Intronic
962079539 3:132122667-132122689 ATTCCAAATAATTGAAAAGGAGG + Intronic
962511926 3:136110190-136110212 GTTCTCAACTACTTAAAAGGTGG + Intronic
962692266 3:137910893-137910915 ATTCCAAACAACTGAAAAGGAGG + Intergenic
962983629 3:140513671-140513693 ATTCCAAACAATTGAAAAGAAGG - Intronic
963493523 3:146031133-146031155 ATTCCAAACAAATAAAAAGGAGG - Intergenic
963617848 3:147566053-147566075 GTTCTAAAAAATTAACAAAGAGG + Intergenic
963628963 3:147709655-147709677 ATTCTAAACAATAGAAAAAGAGG - Intergenic
963803949 3:149704231-149704253 GATTTTAACAAATTAAAAGGGGG + Intronic
964049097 3:152369546-152369568 ATTCCAAACAATATAAAAAGAGG - Intronic
964081631 3:152765865-152765887 ATTCCAAACAACTGAAAAGGAGG + Intergenic
964153643 3:153559328-153559350 ATTCCAAACAATTGAAAAGGAGG + Intergenic
964183670 3:153916813-153916835 ATCCCAAACAATTGAAAAGGAGG + Intergenic
964197125 3:154077984-154078006 TTTTTGAACCATTTAAAAGGGGG - Intergenic
964779963 3:160326280-160326302 ATTCCAAAAAATTAAAAAGGAGG + Intronic
964831587 3:160889606-160889628 ATTCCAAACAGTTGAAAAGGAGG + Intronic
964878580 3:161398032-161398054 ATTCCAAACAACTGAAAAGGAGG + Intergenic
964900673 3:161655093-161655115 CTTCCAAACAATGGAAAAGGAGG - Intergenic
965263705 3:166514367-166514389 ATTTAAAACAATTGAAAAGGAGG + Intergenic
965295302 3:166937779-166937801 AATCTAAACAATTTAAAGGGAGG - Intergenic
965832511 3:172808855-172808877 GTTCTAAATACTTTGGAAGGAGG - Intronic
965854306 3:173069590-173069612 ATTCTAAACAATTGAGGAGGAGG + Intronic
965855763 3:173086071-173086093 ATTCCAAACAATTGAAAAGGAGG - Intronic
966080910 3:175999092-175999114 ATTCCAAACATTTCAAAAGGAGG + Intergenic
966133898 3:176676427-176676449 ACTCCAAACAATTGAAAAGGAGG + Intergenic
966346435 3:178985876-178985898 ATTCTAAACAATAGAAAAAGAGG - Intergenic
966488580 3:180500286-180500308 ATTCCAAAAAATTAAAAAGGAGG - Intergenic
966539307 3:181071881-181071903 ATTCCAAATAATTTAAAAGGAGG - Intergenic
968217889 3:196909368-196909390 TTTCATAACAATTGAAAAGGAGG + Intronic
968576771 4:1370104-1370126 GTTTTAAACCATTAAAAAGATGG - Intronic
968692468 4:2000752-2000774 ATTCCAAACAATTGAAAAGGAGG + Intronic
969132171 4:4998913-4998935 ATTCCAAACAATTGAAAAAGAGG - Intergenic
970055011 4:11961814-11961836 ATTCCAAACAATAGAAAAGGAGG - Intergenic
970165250 4:13230320-13230342 ATTCCAAACAATTGAAATGGAGG + Intergenic
970217435 4:13774797-13774819 GTTCTAAGCACTTTTAAAGTAGG + Intergenic
970290909 4:14571251-14571273 ATTCCAAACAACTGAAAAGGAGG + Intergenic
970380031 4:15497823-15497845 GTTCTGCACATTTTAAAAGCAGG + Intronic
970666174 4:18339779-18339801 ATTCCAAACAATTCCAAAGGAGG - Intergenic
970685567 4:18563007-18563029 ATTCCAAACAATAGAAAAGGAGG + Intergenic
970728619 4:19076844-19076866 AGAATAAACAATTTAAAAGGTGG + Intergenic
970759389 4:19465986-19466008 CTTCTAAAAAATTGAAGAGGTGG + Intergenic
971088962 4:23317056-23317078 GTTCAGAACAATTTAAAAGAAGG - Intergenic
971270125 4:25135656-25135678 ATTCCAAACAATTGAAAAGGAGG + Intronic
971429214 4:26546341-26546363 GTTCCAAACAATTGAAAAGGTGG - Intergenic
971470627 4:27022015-27022037 GTTCTACCAAATTTAAAAGGGGG - Intronic
971516978 4:27499412-27499434 ATTCCAAATAATTGAAAAGGAGG + Intergenic
971575908 4:28274284-28274306 ATTCCAAACAATTGAAAAGGAGG - Intergenic
971648011 4:29233243-29233265 GTTCCAAACAATAGAAAAAGAGG + Intergenic
971734211 4:30425308-30425330 ATGCCAAACAATTGAAAAGGAGG + Intergenic
971816302 4:31495040-31495062 GTCCTAAACATTTTAAATGAGGG - Intergenic
971853379 4:32012325-32012347 ATTCCAAACAATTGAAAATGAGG + Intergenic
971887370 4:32469557-32469579 GTTCTAAAAAATTTTAATTGGGG + Intergenic
971952466 4:33371715-33371737 ATTCCAAACAATTGAAAAGGAGG + Intergenic
972084766 4:35201701-35201723 GGGCTGAACAATTTCAAAGGAGG - Intergenic
972175770 4:36403883-36403905 GTAATAAAAAATTTAAAAAGTGG - Intergenic
972363686 4:38352841-38352863 ATTCTAAAAAATCTAGAAGGAGG + Intergenic
972753538 4:42018941-42018963 TTTTTTAAAAATTTAAAAGGCGG + Intronic
972918986 4:43914697-43914719 ATTCCAAAAAATTAAAAAGGAGG + Intergenic
972985392 4:44757384-44757406 GTTTTAAATAATTGAAAAGTTGG - Intergenic
973050359 4:45588053-45588075 ATTCCAAACAATATAAAAAGAGG + Intergenic
973210681 4:47612098-47612120 ATTCCAAAAAATTGAAAAGGAGG - Intronic
973913705 4:55611059-55611081 GTTCTAAAATATTAAAAAGTTGG + Intronic
974048358 4:56916359-56916381 GTTGTAAAGAATTTAAAAGCAGG + Intronic
974085790 4:57259722-57259744 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
974180902 4:58383511-58383533 ATTCCAAACTATTGAAAAGGAGG - Intergenic
974271795 4:59659549-59659571 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
974325709 4:60412483-60412505 GGTGTAATCAATTTAAAATGAGG - Intergenic
974346660 4:60691255-60691277 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
974605113 4:64141961-64141983 ATTCCAAACAATTGAAAAGGAGG - Intergenic
974760689 4:66269840-66269862 GTTTCAAACAATTGAAAAGGTGG + Intergenic
974768992 4:66386173-66386195 ATTTCAAACAATTGAAAAGGAGG + Intergenic
974814309 4:66985707-66985729 ATTCCAAACAATTGAAAAGGAGG - Intergenic
974912921 4:68145435-68145457 ATTCCAAACAATTGAAAAGGAGG - Intergenic
975212626 4:71718966-71718988 ATTCCAAACAATTGAAAAGGAGG - Intergenic
975392027 4:73831636-73831658 GTTCTCAATAACTTAAAATGTGG + Intergenic
975479651 4:74863424-74863446 ATTCAAAACAATAGAAAAGGAGG + Intergenic
975847566 4:78541089-78541111 GTTCACAACAATTTACAAGATGG + Intronic
975952545 4:79791160-79791182 ATTCAAAACAATTGAAAAGGGGG - Intergenic
975961309 4:79909809-79909831 TTTTTCAAAAATTTAAAAGGAGG + Intronic
976375952 4:84345050-84345072 ATTCCAAACAATTGAAAAGGAGG + Intergenic
976527534 4:86111763-86111785 AGTCCAAACAATTGAAAAGGAGG - Intronic
976532088 4:86167323-86167345 ATTCCAAACAATTGAAAAGGAGG + Intronic
976537855 4:86239383-86239405 ATTCCAAACAATTGAAAAGGAGG - Intronic
976769760 4:88638196-88638218 ATTCTAAACAATTGAAAAGGAGG + Intronic
976793103 4:88902212-88902234 ATTCCAAAAAATTGAAAAGGAGG + Intronic
976807087 4:89060302-89060324 ATTCTAAACAATTTAGAAGGAGG - Intronic
976807981 4:89069552-89069574 GTTCAAAACAAGTTAAAATAAGG + Intronic
976845116 4:89480059-89480081 ATTCCAAACAATTGAAAAGGAGG + Intergenic
976994691 4:91415938-91415960 ATTCCAAACAATTGAAAATGAGG - Intronic
977060433 4:92252564-92252586 ATTCCAAACAATTGGAAAGGAGG - Intergenic
977086223 4:92602117-92602139 ATTCCAAACAATTGAAAAGGAGG + Intronic
977329609 4:95621104-95621126 GATGTAAACATTTTAAAAGTGGG + Intergenic
977462319 4:97340474-97340496 GTTCCAAACAATTGAAAATGAGG + Intronic
977494621 4:97759432-97759454 GTTTTAACCAATTTAATAGAGGG + Intronic
977508696 4:97934892-97934914 ATTCCAAACAACTGAAAAGGTGG - Intronic
977515216 4:98013482-98013504 ATTCCAAACAGTTGAAAAGGAGG - Intronic
977737477 4:100434480-100434502 ATTTTAAATAATTGAAAAGGAGG + Intronic
978023749 4:103847108-103847130 ATTCCAAACAATATAAAAAGAGG + Intergenic
978095907 4:104777352-104777374 ATTCCAAAAAATTAAAAAGGAGG - Intergenic
978212143 4:106149799-106149821 GTTTTATACAAATTAAAAGTTGG - Intronic
978288514 4:107108793-107108815 ATTCCAAACAGTTGAAAAGGAGG + Intronic
978328213 4:107582790-107582812 ATTCCAAACAATTGAAAAGGAGG + Intergenic
978657173 4:111078159-111078181 ATTCCAAACAATTGAAAAGGAGG + Intergenic
978896857 4:113899126-113899148 GTTCTTAAGAATTTTAAAAGGGG + Intergenic
978940124 4:114426277-114426299 ATTCGAAACAACTGAAAAGGAGG - Intergenic
978977444 4:114895591-114895613 GTTCTAAACAATTTAAAAGGAGG + Intronic
979068183 4:116166336-116166358 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
979174611 4:117647925-117647947 GTTCCAAAAAATTGAATAGGAGG - Intergenic
979197521 4:117938335-117938357 ATTCCAAACAACTGAAAAGGAGG - Intergenic
979220507 4:118218147-118218169 ATTCCAAACAATTGAAAAGAAGG + Intronic
979373595 4:119918096-119918118 ATTCCAAACAATCGAAAAGGAGG + Intergenic
979529369 4:121752646-121752668 ATTCCAACCAATTGAAAAGGAGG + Intergenic
979628204 4:122870364-122870386 ATTCCAAACAATTGAAAAGGAGG - Intronic
979725746 4:123958818-123958840 ATTCCAAACAATTGAAAAGAAGG + Intergenic
979742717 4:124171097-124171119 ATTCCAAACAATTGAAAAGGAGG + Intergenic
979978278 4:127223846-127223868 ATTCCAAACAATTGAAAAGGAGG - Intergenic
980346494 4:131628278-131628300 ATTCCAAACATTTGAAAAGGAGG + Intergenic
980480955 4:133386326-133386348 GTTTTAAACTATTGAAAAGAAGG + Intergenic
980512822 4:133815825-133815847 ATTCCAAACAACTGAAAAGGAGG + Intergenic
980787056 4:137569604-137569626 ATTCCAAACAATTGAAAAGGAGG - Intergenic
980865160 4:138545794-138545816 ATTCCAAACAATTGAAAAGAAGG + Intergenic
981062943 4:140446204-140446226 ATTCCAAAAAATTGAAAAGGAGG - Intronic
981187350 4:141819288-141819310 ATTCCAAACAATTGCAAAGGAGG + Intergenic
981631548 4:146824638-146824660 ATTCCAAACAATTTAAAGGAAGG - Intronic
981664963 4:147213887-147213909 GTTCCAAAAAATTGCAAAGGAGG - Intergenic
981989592 4:150901710-150901732 GTTCTGAACCACTTAAAAGCAGG + Intronic
982294994 4:153818835-153818857 GTTCCAAACAATTGAAAAGGAGG + Intergenic
982848573 4:160281181-160281203 ATTCCAAACAATTGAAAAGAAGG + Intergenic
983134608 4:164065186-164065208 ATTTCAAACAATTGAAAAGGAGG - Intronic
983315750 4:166131090-166131112 ATTCTAAACAATTGAAAAGGAGG - Intergenic
983355262 4:166648780-166648802 ATTCCAAACAATTGAAAAGGAGG - Intergenic
983958062 4:173720096-173720118 ATTCCAAACAATTGAAAAGGAGG + Intergenic
983972052 4:173887625-173887647 ATTGCAAACAATTGAAAAGGAGG - Intergenic
984076060 4:175181460-175181482 ATTTCAAACAATTGAAAAGGAGG - Intergenic
984136319 4:175943916-175943938 GTTCCAAACAATAGAAAAAGAGG - Intronic
984216129 4:176914632-176914654 ATTCCAAACAACTGAAAAGGAGG + Intergenic
984283509 4:177701035-177701057 GTTCCAAACAATAGAAAAAGAGG - Intergenic
984301057 4:177918217-177918239 GTTCCAAACAATAGAAAAAGAGG + Intronic
984324709 4:178237155-178237177 ATTCAAAACAATTGAAAAGAAGG - Intergenic
984625775 4:182006262-182006284 GTTCCAAAAAACTGAAAAGGAGG - Intergenic
985012470 4:185597946-185597968 TTTCTCAAAAATTTAAAACGTGG - Intronic
985157321 4:187003024-187003046 ATTCCAAACAATTGAAAATGAGG + Intergenic
985340355 4:188945948-188945970 ATTCCAAACAATTGAAAAGCTGG + Intergenic
985405864 4:189637736-189637758 GTTGTTAACAAGTTAAAAGAAGG + Intergenic
986140896 5:5028651-5028673 ATTCCAAATAATTGAAAAGGAGG + Intergenic
986172106 5:5323538-5323560 ATTCCAAACAACTGAAAAGGAGG - Intergenic
986358874 5:6955732-6955754 GTTCCAAACAATAGAAAAAGAGG + Intergenic
986628730 5:9748343-9748365 GTTTAAAACAATTTAAAAAGAGG + Intergenic
986915112 5:12610183-12610205 ATTCCAAACAATTGAAAAGAAGG - Intergenic
987399496 5:17460537-17460559 ATTCCAAACAATTGAAAAGGAGG - Intergenic
987471397 5:18333213-18333235 ATTCCAAACAATTGAAAAGGAGG + Intergenic
987530901 5:19118095-19118117 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
987584244 5:19834054-19834076 ATTCCAAACAATTGAAAAGAAGG - Intronic
987596824 5:20011974-20011996 ATTCCAAAAAATTGAAAAGGAGG - Intronic
987834397 5:23142977-23142999 ATTCCAAACAATTGAAAAGGAGG - Intergenic
987837104 5:23175865-23175887 ATTCTAAACAATTAAAAAGGAGG - Intergenic
987909828 5:24126845-24126867 ATTCCAAACAATTGAAAAGGAGG - Intronic
988059816 5:26152114-26152136 ATTCCAAACAATTGAAAAGGAGG + Intergenic
988110792 5:26816309-26816331 ATTTCAAACAATTGAAAAGGAGG + Intergenic
988719532 5:33862648-33862670 ATTCCAAACAATTGAAAAAGAGG + Intronic
989092390 5:37746873-37746895 ATTCCAAACAATTGAAAAGGAGG + Intronic
989222770 5:38987259-38987281 GTTCCAAACAATAGAAAAAGTGG - Intronic
989276465 5:39595669-39595691 ATTCCAAACAATTGAAAAGGAGG - Intergenic
989393416 5:40925864-40925886 CTTCCAAAAAATTGAAAAGGAGG + Intronic
989676387 5:43978388-43978410 ATGCCAAACAATTGAAAAGGAGG - Intergenic
989697157 5:44214937-44214959 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
989812297 5:45694040-45694062 GTTCTTTAGAATTTTAAAGGTGG - Intronic
990064943 5:51700818-51700840 ATTCCAAACAACTGAAAAGGAGG - Intergenic
990138742 5:52679214-52679236 ATTCCAAAGAATTGAAAAGGAGG - Intergenic
990195248 5:53307662-53307684 ATTCCAAACAATAGAAAAGGAGG - Intergenic
990317608 5:54598342-54598364 ATTCCAAACAATTGAAAAGGAGG + Intergenic
990360152 5:55010599-55010621 ATTCTAAAAAATTGAAAAGGAGG + Intronic
990841168 5:60080915-60080937 ATTCCAAACAATTGAAAAGGAGG - Intronic
991346804 5:65677443-65677465 ATTCTAAAAAATTGAAAAGGAGG + Intronic
992227297 5:74631484-74631506 GTGCTAAAACATTTAAGAGGGGG - Intronic
992355660 5:75980319-75980341 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
992364654 5:76079385-76079407 GTTGTAGACAATCTTAAAGGAGG + Intergenic
992437079 5:76764957-76764979 CTTCCAAAAAATTAAAAAGGAGG - Intergenic
992572057 5:78068707-78068729 ATTCCAAACAATTGAAAAGGAGG + Intronic
993020099 5:82581749-82581771 ATGCCAAACAATTGAAAAGGTGG - Intergenic
993336158 5:86661550-86661572 ATTCCAAACAATTGAGAAGGAGG - Intergenic
993392708 5:87340615-87340637 GTTCAAAACATAGTAAAAGGGGG + Intronic
993544695 5:89196837-89196859 GTTCCAAAAAATTGAAAAGGAGG - Intergenic
993548965 5:89249962-89249984 GTTCTAAAGATTTTATAAGAGGG + Intergenic
993586998 5:89743748-89743770 ATTCCAAAAAATTAAAAAGGAGG - Intergenic
993605508 5:89986314-89986336 GTTTTAAAGAGTTTAAAATGGGG + Intergenic
993750062 5:91654567-91654589 GTTCCAAAAAACTGAAAAGGAGG + Intergenic
993808227 5:92439417-92439439 ATTCCAAACAATTGCAAAGGAGG + Intergenic
993821280 5:92619998-92620020 TTTCCAAACAATTGAAAAGGAGG - Intergenic
993837366 5:92832008-92832030 ATTCCAAACAATTGAAAAAGAGG - Intergenic
994010296 5:94894578-94894600 GTTGTAAACAATTTACCTGGAGG - Intronic
994127646 5:96186885-96186907 ATTCCAAATAATTGAAAAGGAGG - Intergenic
994189164 5:96848738-96848760 CTTCCAAAGAATTTAAAAGGAGG + Intronic
994234998 5:97352523-97352545 GTTCCCAAGAATTGAAAAGGAGG - Intergenic
994254937 5:97581600-97581622 GTTCTTAGCAATGAAAAAGGAGG - Intergenic
994345695 5:98683396-98683418 ATTCTAAACAATAGAAAAAGAGG + Intergenic
994350993 5:98745931-98745953 ATTCCAAACAATTGAAAAGGAGG + Intergenic
994437741 5:99760437-99760459 ATTCCAAACAATATAAAAAGAGG - Intergenic
994512073 5:100716957-100716979 TTTCCAAAAAATTGAAAAGGAGG - Intergenic
994593063 5:101796045-101796067 ATTCCAAACAATTGAAAAGCAGG + Intergenic
994696299 5:103076619-103076641 ATTCCAAACAATTGAAAAGGAGG - Intergenic
995003341 5:107161385-107161407 ATTCCAAACAATTGAAAAGGAGG + Intergenic
995052559 5:107722852-107722874 ATTCCAAACAATTGAGAAGGAGG + Intergenic
995081064 5:108051191-108051213 ATTCCAAACAATTGAAAAGGAGG + Intronic
995110699 5:108425384-108425406 ATTCCAAACAATTCAGAAGGAGG - Intergenic
995578718 5:113571513-113571535 ATTCCAAACAACTGAAAAGGAGG - Intronic
995593731 5:113726787-113726809 ATTCCAAACAATTGAAAAGGAGG - Intergenic
995685017 5:114763145-114763167 ATTCCAAACAATTGAAAAGGAGG - Intergenic
995765134 5:115606199-115606221 CTTCAAAAAAATTCAAAAGGAGG + Intronic
996006264 5:118424131-118424153 ATTCCAAACAATTGAAAAGGAGG + Intergenic
996194015 5:120581057-120581079 ATTCCAAACAATTGAAAAGGAGG - Intronic
996287394 5:121810562-121810584 ATTCCAAACAATTGAAAAGGAGG - Intergenic
996390809 5:122959030-122959052 TTTCCAAAAAATTTAACAGGAGG - Intronic
996414458 5:123195201-123195223 GGTCTAAGCAACTGAAAAGGTGG + Intergenic
996592602 5:125164293-125164315 ATTCCAAACAATTGAAAAGGAGG + Intergenic
996778215 5:127156083-127156105 ATTCTAAAAAATTGAAAAGGAGG - Intergenic
996878660 5:128268480-128268502 ATTCCAAACAATTGAAAAGTAGG + Intronic
996917476 5:128729546-128729568 ATTCCAAACAACTGAAAAGGGGG + Intronic
996965460 5:129302672-129302694 ATTCCAAACAATTGAAAAGGAGG - Intergenic
996969617 5:129348622-129348644 GTTTCAAAAAATTGAAAAGGAGG - Intergenic
997053307 5:130408947-130408969 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
997054035 5:130419224-130419246 ATTCTAAACCATTGAAAAAGAGG + Intergenic
997217513 5:132125957-132125979 ATTCTAAATAATTGAAAAAGAGG - Intergenic
997220016 5:132153962-132153984 ATTCCAAACAATAGAAAAGGAGG - Intergenic
997706710 5:135961248-135961270 ATTCCAAACAATTGAAAAGGAGG + Intergenic
997804373 5:136900633-136900655 ATTCCAAACAGTTGAAAAGGAGG - Intergenic
997910381 5:137866155-137866177 ATTCTAAGCAATTTTAAATGTGG - Intergenic
998294738 5:140956682-140956704 ATTCCAAACAATGGAAAAGGAGG - Intronic
998645568 5:144057815-144057837 ATTCCAAACAATTGAAAAGGAGG + Intergenic
998976556 5:147655237-147655259 ATTCCAAACAATTTAAAAGGAGG - Intronic
999053225 5:148546393-148546415 GAACTAAACATTTTAAAAGCTGG + Intronic
999620925 5:153472472-153472494 ATTCCAAAGAATTGAAAAGGAGG - Intergenic
999938947 5:156519473-156519495 ATTCCAAACAATTGAAAAGGAGG + Intronic
1000032305 5:157413841-157413863 GTTGCAAAAAATTGAAAAGGAGG + Intronic
1000213474 5:159131839-159131861 TTACTAAATAATTTAAAAAGGGG - Intergenic
1000407720 5:160906438-160906460 CTTCTAAACACTTTGGAAGGAGG + Intergenic
1000509935 5:162168215-162168237 ATTCCAAACAATGGAAAAGGAGG + Intergenic
1000584210 5:163076427-163076449 ATTCCAAACAGTTGAAAAGGAGG - Intergenic
1000709193 5:164549470-164549492 GTTCCAATCAATGGAAAAGGAGG - Intergenic
1000995729 5:167957008-167957030 ATTCCAAACAATTGAAAAAGAGG - Intronic
1001165100 5:169357545-169357567 GTTCCAAAAAATTGAAGAGGAGG + Intergenic
1001190350 5:169624704-169624726 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1001343967 5:170873383-170873405 ATTCCAAACAACTGAAAAGGAGG - Intronic
1001355557 5:171019293-171019315 ATTCCAAACAATTGAAAAGGAGG - Intronic
1001384528 5:171327938-171327960 GTTGTAAATAATTGATAAGGAGG + Intergenic
1001844341 5:174907985-174908007 ATTCTAAACAATTAAAAAGGAGG + Intergenic
1003249080 6:4409342-4409364 ATTCCGAACAATTGAAAAGGAGG + Intergenic
1003438423 6:6116724-6116746 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1003713249 6:8617109-8617131 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1003803133 6:9694161-9694183 ATTCCAAACAATTGAAAAGGAGG + Intronic
1005785521 6:29241516-29241538 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1005795101 6:29351744-29351766 ATTTCAAACAATTCAAAAGGAGG - Intergenic
1005924026 6:30426335-30426357 ATTCCAAACAATTGAAAAGGGGG + Intergenic
1006240765 6:32676367-32676389 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1006349470 6:33510397-33510419 TTTCTAGACTACTTAAAAGGAGG - Intergenic
1007902789 6:45425565-45425587 GTGTTAAACAATTCAAAAAGTGG + Intronic
1008135868 6:47776323-47776345 TTTTTAAACAATTAAAAAAGTGG + Intergenic
1008402735 6:51082706-51082728 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1008467913 6:51851433-51851455 ATTCCAAACAATTGAAAAGGAGG - Intronic
1008889722 6:56474181-56474203 TTTCTAAAGAATATAAAATGTGG + Intronic
1009048824 6:58256478-58256500 ATTAGAAACAATTTCAAAGGAGG + Intergenic
1009196039 6:60685807-60685829 ATTCTAAACAAATTAAAATAAGG - Intergenic
1009200972 6:60744708-60744730 TATGTAAACATTTTAAAAGGGGG - Intergenic
1009224684 6:61011224-61011246 ATTAGAAACAATTTCAAAGGGGG + Intergenic
1009279255 6:61725903-61725925 ATTCCAAAAAATTGAAAAGGAGG + Intronic
1009336399 6:62495622-62495644 ATTCTAAGCAATAGAAAAGGAGG + Intergenic
1009367334 6:62865658-62865680 GTTTTAAACAATAACAAAGGGGG + Intergenic
1009580876 6:65532107-65532129 ATTTTAAATACTTTAAAAGGTGG + Intronic
1009597212 6:65751182-65751204 ATTCCAAACAATTGAAAAAGAGG + Intergenic
1009675959 6:66821635-66821657 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1010482899 6:76376047-76376069 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1010493697 6:76505766-76505788 ATTCCAAACAGTTGAAAAGGAGG - Intergenic
1010680491 6:78793292-78793314 ATTTTAAACAATTTTATAGGAGG + Intergenic
1010836754 6:80597846-80597868 ATTCCAAACAATTAAAAAGGAGG - Intergenic
1010914845 6:81603197-81603219 ATTCCAAGCAATTGAAAAGGAGG + Intronic
1011073024 6:83406365-83406387 ATTCCAAACAATCGAAAAGGAGG - Intronic
1011229827 6:85148139-85148161 ATTCCAAACAATATAAAAAGAGG - Intergenic
1011321427 6:86097834-86097856 ATTCCAAACAATTGAGAAGGAGG + Intergenic
1011833550 6:91403287-91403309 TTTCCAAACAATGTAAAATGTGG + Intergenic
1011916629 6:92513933-92513955 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1011944476 6:92883702-92883724 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1012155756 6:95818094-95818116 ATTCCAAAAAATTGAAAAGGTGG + Intergenic
1012211903 6:96529896-96529918 TTTCTGAACAATTTGAGAGGAGG + Intronic
1012213621 6:96556079-96556101 GATCTGATGAATTTAAAAGGGGG - Intergenic
1012232072 6:96771697-96771719 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1012434503 6:99200916-99200938 ATTCCAAACAATTGAAAATGAGG - Intergenic
1012490348 6:99776527-99776549 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1012679776 6:102165372-102165394 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1012688644 6:102285881-102285903 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1012784277 6:103603486-103603508 ATTCCAAACAATTGAAATGGAGG - Intergenic
1012785489 6:103620052-103620074 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1013423503 6:109988577-109988599 ATTCCAAACAAATGAAAAGGAGG - Intergenic
1013484169 6:110579797-110579819 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1013804407 6:113981513-113981535 TTTCTAAACCACTTAAAAGTAGG + Intronic
1013919778 6:115390168-115390190 ATTCCAAACAATTAAAAAGGAGG - Intergenic
1013930050 6:115519699-115519721 ATTCCAAACAATAGAAAAGGTGG + Intergenic
1014065001 6:117114159-117114181 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1014085127 6:117333449-117333471 GTTCCAAACAATGGAAAAGGAGG + Intronic
1014256641 6:119167020-119167042 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1014367219 6:120559698-120559720 ATTCCAAACAATTGAAAAAGAGG - Intergenic
1014375534 6:120667808-120667830 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1014393241 6:120891544-120891566 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1014484438 6:121981752-121981774 ACTCCAAACAATTGAAAAGGAGG - Intergenic
1014564068 6:122927142-122927164 ATTCCAAAAAATTAAAAAGGAGG - Intergenic
1014569372 6:122989807-122989829 GTTCCAAACAATAGAAAAAGAGG + Intergenic
1014643925 6:123950337-123950359 GTTTTAAAAAATTGGAAAGGAGG - Intronic
1014731797 6:125040544-125040566 ATTCCAAACAATTGAAAAGGAGG + Intronic
1014785903 6:125618940-125618962 GTTCTGAAGAATTTATAAGCTGG + Intergenic
1014823208 6:126016560-126016582 TTTCTAAAGACTTTAAAAAGTGG + Intronic
1014864333 6:126509126-126509148 ATTGCAAACAATTGAAAAGGAGG + Intergenic
1015136683 6:129880067-129880089 ATTCTAAACAACTGAAAAGGAGG - Intergenic
1015368267 6:132422086-132422108 ATTCCAAACAATTGAAAAGAAGG - Intergenic
1015587699 6:134792803-134792825 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1015651676 6:135468961-135468983 ATTCCAAATAATTGAAAAGGAGG + Intronic
1015719041 6:136222311-136222333 ATTCCAAACAATTGAAAAGAAGG + Intergenic
1015809393 6:137146572-137146594 TTTCTAAACAAGTTAAACTGTGG + Intronic
1016288678 6:142504189-142504211 ATTCCAAAAAATTAAAAAGGAGG - Intergenic
1016423427 6:143909432-143909454 ATTCCAAAAAATTGAAAAGGAGG - Intronic
1016593933 6:145777340-145777362 ATTCCAAACAGTTGAAAAGGAGG - Intergenic
1016618861 6:146083769-146083791 ATTCCAAACAATTGAAAAGGAGG - Intronic
1016638327 6:146320501-146320523 ATTCCAAACAATATAAAAAGAGG - Intronic
1016866226 6:148770006-148770028 GTTCTTTACAATTTAAAGTGAGG - Intronic
1017116445 6:150981783-150981805 GTTGGCAACATTTTAAAAGGTGG + Intronic
1017302683 6:152880759-152880781 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1017390800 6:153937265-153937287 ATCCCAAACAATTGAAAAGGAGG - Intergenic
1017394581 6:153982193-153982215 ATTCCAAACAATTGAAGAGGAGG - Intergenic
1018348209 6:162925269-162925291 ATTCCAAACAACTGAAAAGGAGG + Intronic
1018578574 6:165286386-165286408 CTTCCAAACAATTGAAAAGGAGG + Intronic
1019113200 6:169734824-169734846 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1020423126 7:8032860-8032882 CTTCTAAAAAATAGAAAAGGAGG + Intronic
1020619454 7:10500371-10500393 ATTCTAAACAACTGAAAAGAGGG + Intergenic
1020734153 7:11925576-11925598 GTTTTATACAATTTAAATGGAGG + Intergenic
1020885335 7:13813159-13813181 GTTCCAAACAATAGAAAAAGAGG + Intergenic
1020916238 7:14197207-14197229 TTTTTAAACTATTAAAAAGGGGG - Intronic
1020926328 7:14331110-14331132 TTGCTAAAAAATTTCAAAGGAGG + Intronic
1021324744 7:19253061-19253083 GTTGTACTCAAGTTAAAAGGAGG + Intergenic
1021390947 7:20092037-20092059 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1021520318 7:21533315-21533337 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1022075948 7:26970702-26970724 ATTCCAAAAAATTGAAAAGGAGG - Intronic
1022542160 7:31147283-31147305 ATTCCAAACAATTGAAAAAGAGG + Intergenic
1022686164 7:32598890-32598912 ATTCCAAACAATTGAAGAGGAGG + Intergenic
1023168606 7:37368173-37368195 ATTCTAAACATTTTAAGAAGGGG + Intronic
1023195903 7:37638833-37638855 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1023363232 7:39437157-39437179 ATTCCAAACAATTGAAAAGGAGG - Intronic
1023465092 7:40445602-40445624 ATTCCAAACAATTGAAAAAGAGG + Intronic
1024034051 7:45491999-45492021 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1024590297 7:50875984-50876006 ACTCCAAACAATTAAAAAGGAGG + Intergenic
1024778585 7:52819008-52819030 GTTGTAAAAAATTTAAGAGATGG + Intergenic
1024907610 7:54405776-54405798 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1025042067 7:55654937-55654959 ATTCTAAAAAATTGAAAAGGAGG + Intergenic
1025856392 7:65283675-65283697 ATTCAAAAAAATTGAAAAGGAGG + Intergenic
1025862750 7:65347204-65347226 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1027340321 7:77200826-77200848 ATGCAAAACAAATTAAAAGGAGG - Intronic
1027622925 7:80514382-80514404 GGGCTTAACAATTGAAAAGGAGG - Intronic
1027731601 7:81881295-81881317 ATTCAAAACAATTGAAAAGGAGG + Intergenic
1027863782 7:83620452-83620474 ATTCCAAACAATTGAAAAGGAGG + Intronic
1027944409 7:84726505-84726527 ATTTCAAACAATTGAAAAGGAGG + Intergenic
1028027947 7:85870035-85870057 ATTCCAAACAATTGAAAAGGGGG + Intergenic
1028442845 7:90883543-90883565 ATTCCAAACAATTGAAAAAGAGG + Intronic
1028459507 7:91075096-91075118 ATTCCAAACAATTGAAAAGGAGG + Intronic
1028468298 7:91176914-91176936 ATTCTAATCAATAGAAAAGGAGG + Intronic
1028626786 7:92886842-92886864 ATTCCAAACAATTAAAAAAGCGG - Intergenic
1028644483 7:93079993-93080015 ATTCTAAACAACTTAAAAGGAGG + Intergenic
1028677950 7:93489864-93489886 ATTCTGAAGAATTGAAAAGGAGG + Intronic
1028992097 7:97060094-97060116 ATTCCAAACAATTGAACAGGAGG + Intergenic
1029039813 7:97561128-97561150 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1029041784 7:97583624-97583646 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1029322257 7:99774297-99774319 TTTCTGAACAATAGAAAAGGAGG + Intronic
1029877177 7:103766556-103766578 GTGCTAAAAAATATAAAAGGAGG + Intronic
1030159835 7:106495930-106495952 ATTCCAAACAATAGAAAAGGAGG + Intergenic
1030256891 7:107519749-107519771 ATTCCAAACAACTGAAAAGGAGG + Intronic
1030268109 7:107641717-107641739 GTTCTAGACTATATAAAAAGAGG + Intergenic
1030390910 7:108927577-108927599 GTTTCAAAAAATTGAAAAGGAGG - Intergenic
1030701244 7:112643624-112643646 ACTCCAAACAATTGAAAAGGAGG - Intergenic
1030705300 7:112686589-112686611 ATTCCAAACAATATAAAAAGAGG - Intergenic
1030919527 7:115364329-115364351 CTTCTAAAAAATTTAAGAGGGGG - Intergenic
1031189411 7:118528196-118528218 ATTCCAAACAATTGAAAAGTAGG + Intergenic
1031245519 7:119306607-119306629 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
1031267682 7:119601922-119601944 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1031711347 7:125049905-125049927 ATTCCAAACAATATAAAAAGAGG + Intergenic
1032003227 7:128280090-128280112 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1032370413 7:131344750-131344772 CTTTTAAACAAAATAAAAGGAGG + Intronic
1032777149 7:135125498-135125520 ACTCCAAACAATTGAAAAGGAGG + Intronic
1032807223 7:135368021-135368043 GTTCTAAACAATTTGAGGGCAGG + Intronic
1032842094 7:135722406-135722428 TTTATAAACAATCCAAAAGGTGG + Intronic
1032920257 7:136537476-136537498 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1032926470 7:136611494-136611516 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1033791927 7:144800643-144800665 ATTCCAAACAATTGAAAAGGCGG + Intronic
1034363593 7:150524295-150524317 GATCAGAACAATTTCAAAGGAGG - Intergenic
1035492012 7:159288058-159288080 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1035554847 8:559349-559371 ATTCCAAACAATTGGAAAGGAGG + Intergenic
1035599159 8:885936-885958 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1037410956 8:18596926-18596948 GTTCCAAAAAATTGAAGAGGAGG + Intronic
1037464540 8:19147461-19147483 GTTCAGAACAATGTAAAAAGAGG + Intergenic
1038036697 8:23692133-23692155 GTTTTAAACACTTAAAAAAGTGG + Intergenic
1038093701 8:24283862-24283884 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1039007237 8:33053238-33053260 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1039145494 8:34441961-34441983 ATTCCAAACAATTGAAAAGAGGG + Intergenic
1039265532 8:35819590-35819612 ACTCCAAACAATTGAAAAGGAGG + Intergenic
1039293517 8:36124452-36124474 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1039302739 8:36227299-36227321 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
1039402576 8:37282831-37282853 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1039636749 8:39175713-39175735 ATTCCAAACAATTGAAAAGAAGG - Intronic
1039685597 8:39798575-39798597 ATTCCAAACAATTGAAAAGGAGG - Intronic
1039820823 8:41133378-41133400 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1040544539 8:48387835-48387857 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1040748391 8:50674211-50674233 ATTCCAAACAATCCAAAAGGAGG - Intronic
1041021061 8:53639255-53639277 ATTCCAAACAATTGCAAAGGAGG - Intergenic
1041079053 8:54198070-54198092 CTTCCAGAAAATTTAAAAGGAGG - Intergenic
1041715843 8:60931200-60931222 ATTCTAAAAAATTGAGAAGGAGG + Intergenic
1041747280 8:61221720-61221742 ATTCCAAACAATTGAAAAGCAGG - Intronic
1041889143 8:62849197-62849219 ATTCCAAAAAATTGAAAAGGAGG - Intronic
1041891473 8:62874421-62874443 ACTCCAAACAATTGAAAAGGAGG + Intronic
1042463109 8:69094047-69094069 GTGGTAAACTATTTAGAAGGGGG + Intergenic
1042643965 8:70965485-70965507 ATTCCAAACAATTGAAAACGAGG - Intergenic
1042725619 8:71872580-71872602 ATTCTAAAAAATTGAAGAGGAGG - Intronic
1042749474 8:72142370-72142392 GTTCTAAAAAATTTGAAGGTTGG - Intergenic
1042759966 8:72260457-72260479 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1042773963 8:72408785-72408807 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1043304669 8:78779773-78779795 ATTCCAAACAATTGAAAAGGAGG - Intronic
1043312155 8:78874124-78874146 ATTCCAAACAATTCAAAAAGAGG - Intergenic
1043313321 8:78889215-78889237 TTTCAAAAGAATTTAAAAGATGG + Intergenic
1043661326 8:82745946-82745968 GTTCTAATTAATTTAGAAAGTGG - Intergenic
1043805337 8:84665355-84665377 ATTCCAAAAAATTGAAAAGGAGG - Intronic
1044107978 8:88235818-88235840 GTTCAAATCAAGTTACAAGGTGG + Intronic
1044113620 8:88306388-88306410 ATTCCAAAAAATTGAAAAGGAGG + Intronic
1044245824 8:89944204-89944226 TCTCTAAGCAATTTAGAAGGGGG + Intronic
1044315517 8:90746102-90746124 ATTCTAAACAATTGAAAAGGAGG - Intronic
1044355914 8:91222871-91222893 ATTCCAAATAATTCAAAAGGAGG - Intronic
1044468107 8:92531168-92531190 ATTCCAAAAAATTTAAAAGGAGG + Intergenic
1044508250 8:93046059-93046081 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1044509096 8:93054805-93054827 ATTCCAAACAATATAAAAAGAGG - Intergenic
1044650544 8:94489869-94489891 GATATCAACAATTTTAAAGGAGG + Intronic
1044758697 8:95493892-95493914 GTTATTAACATTTTAAAAGACGG - Intergenic
1044863708 8:96548597-96548619 GTTTAAAACAAGTGAAAAGGTGG - Intronic
1045151460 8:99413094-99413116 ATTCCAAACAATATAAAAAGAGG - Intronic
1045212855 8:100116867-100116889 ATTCCAAACAGTTGAAAAGGAGG + Intronic
1045595228 8:103647460-103647482 ATTCCAAAAAATTAAAAAGGAGG - Intronic
1045829574 8:106442451-106442473 ATTCCAAACAATCGAAAAGGAGG - Intronic
1045877851 8:107003340-107003362 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1045978138 8:108152660-108152682 ATTCCAAGCAATTGAAAAGGAGG + Intergenic
1046240702 8:111487225-111487247 ATTCCAAACAAATGAAAAGGAGG - Intergenic
1046254282 8:111675794-111675816 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1046429305 8:114103202-114103224 GTTGCAAAAAATTTAAAAGGAGG + Intergenic
1046513455 8:115228003-115228025 ATTCCAAACAATTGAAAATGAGG + Intergenic
1046709183 8:117490266-117490288 ATTCCAAACAAATGAAAAGGAGG + Intergenic
1046987181 8:120401106-120401128 ATTCTAAAAAATTCAAAAGAAGG + Intronic
1047146028 8:122200267-122200289 GTTCCAAACAATAGAAAAAGAGG + Intergenic
1048373031 8:133796402-133796424 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1048606618 8:135975109-135975131 ATTCTAAACAATACAAAAGAGGG - Intergenic
1048630053 8:136232944-136232966 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1048671890 8:136731863-136731885 GTTCTCAACAAATGAAAAGGAGG - Intergenic
1049783160 8:144438202-144438224 TTTCAAAAAAATTTAAAAAGCGG - Intronic
1050239196 9:3616560-3616582 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1050242710 9:3654902-3654924 ATTCTAAAAAATTGAAGAGGGGG - Intergenic
1050390322 9:5136225-5136247 ATTCCAAACAATTGAAAAAGAGG + Intronic
1050393471 9:5170945-5170967 ATTCCAAACAATCAAAAAGGAGG + Intronic
1050403312 9:5280265-5280287 ATTCCAAACAATATAAAAAGAGG + Intergenic
1050408317 9:5333624-5333646 ATTCGAAACAACTGAAAAGGAGG + Intergenic
1050414747 9:5404230-5404252 ATTCCAAACAATTGAAAAGGAGG + Intronic
1050630382 9:7552292-7552314 ATTCAAAACAATTGAAAATGAGG + Intergenic
1050661079 9:7883533-7883555 TTTCCAAACAATTGAAAAGGAGG + Intronic
1050942833 9:11482287-11482309 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1051111336 9:13640663-13640685 CTTCCAAAAAACTTAAAAGGTGG + Intergenic
1051198555 9:14590858-14590880 TTTTTAAAAAATTTAAAAGTAGG - Intergenic
1051207861 9:14708439-14708461 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1051458118 9:17284298-17284320 ATTCCAAACAATTGAAAAGGAGG - Intronic
1051479752 9:17546582-17546604 ATTCCAATCAACTTAAAAGGAGG + Intergenic
1051914214 9:22188534-22188556 TTTCTAGAAAATTGAAAAGGAGG + Intergenic
1051918236 9:22232890-22232912 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1051962583 9:22786240-22786262 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1052154510 9:25167996-25168018 ATTCCAAACAGTTGAAAAGGAGG - Intergenic
1052200078 9:25767476-25767498 ATTTCAAACAATTGAAAAGGAGG + Intergenic
1052717271 9:32132112-32132134 ATTCCAAACAATAGAAAAGGAGG + Intergenic
1052903131 9:33812065-33812087 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1053039032 9:34853498-34853520 ATTCCAAACAATTGAAAAGAAGG - Intergenic
1053340944 9:37330610-37330632 ATTCTAAACATTTTTGAAGGAGG - Intronic
1053347797 9:37390723-37390745 ATTTTAAACAAATTAAAATGTGG - Intergenic
1053448702 9:38174129-38174151 AGTCTAAAGAATTTAAAAAGTGG + Intergenic
1053490073 9:38492657-38492679 GTTCCAAATAGTTGAAAAGGAGG + Intergenic
1053522726 9:38797313-38797335 TTTCCAAAAAATTGAAAAGGAGG - Intergenic
1053785939 9:41653028-41653050 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1054159112 9:61661169-61661191 TTATTAAAAAATTTAAAAGGAGG + Exonic
1054174654 9:61866961-61866983 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1054194951 9:62021733-62021755 CTTCCAAAAAATTGAAAAGGAGG - Intergenic
1054449511 9:65396021-65396043 TTATTAAAAAATTTAAAAGGAGG - Intergenic
1054478886 9:65592174-65592196 TTATTAAAAAATTTAAAAGGAGG + Intergenic
1054643457 9:67566957-67566979 CTTCCAAAAAATTGAAAAGGAGG + Intergenic
1054662884 9:67713832-67713854 TTATTAAAAAATTTAAAAGGAGG + Intergenic
1054719433 9:68589722-68589744 ATTCTAAACAATAGAAAAAGAGG - Intergenic
1054794379 9:69286051-69286073 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1055125372 9:72713310-72713332 ATTCCAAACAATATAAAAAGAGG - Intronic
1055234405 9:74102961-74102983 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1055246253 9:74247425-74247447 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1055343011 9:75305514-75305536 ATTCCAAACAATGGAAAAGGAGG - Intergenic
1055509479 9:76981557-76981579 ATTCCAAACAATTGAAAAGAAGG - Intergenic
1056885584 9:90440646-90440668 ATTCCAAACAATTGAAAAGGGGG - Intergenic
1057018007 9:91671085-91671107 ATTCCAAACAATTGAAAAGGAGG - Intronic
1057712119 9:97455280-97455302 ATTCCAAACAATTGAAAAGGAGG + Intronic
1058184385 9:101837388-101837410 ATTCTAAACAATTGAAAAGGAGG + Intergenic
1058199741 9:102024772-102024794 ATTCCAAAAAATTCAAAAGGAGG - Intergenic
1058374690 9:104308865-104308887 ATTCCAAACAATTAAAAAGAAGG + Intergenic
1058386236 9:104439379-104439401 ATTCTAAACAATCGAAAAGGAGG - Intergenic
1059003889 9:110380726-110380748 ATTCCAAACAATTGAAAAGGAGG - Intronic
1059076959 9:111203565-111203587 ATTCCAAACAACTGAAAAGGAGG + Intergenic
1059132586 9:111769292-111769314 CTTCTAAACAATTGAAGAGGAGG - Intronic
1059262379 9:112990649-112990671 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1059596610 9:115727432-115727454 ATTCCAAACAATTGAAGAGGAGG + Intergenic
1059745893 9:117200898-117200920 ATTCCAAACAATTGAAAAGGAGG - Intronic
1059895452 9:118859216-118859238 ATTCCAAACCATTGAAAAGGAGG + Intergenic
1060567932 9:124610636-124610658 ATTCCAAACAATTGAAAAGTAGG - Intronic
1203459726 Un_GL000220v1:23097-23119 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1203583918 Un_KI270746v1:44861-44883 GTACGAAACATTTTAAAAGTAGG + Intergenic
1203656947 Un_KI270753v1:7158-7180 GTTGTTAACAAGTTAAAAGAAGG + Intergenic
1186142775 X:6594393-6594415 GTGCTCATCAATATAAAAGGTGG + Intergenic
1186523514 X:10227002-10227024 ATTCCAAACAATTGAAAAGGAGG + Intronic
1186678680 X:11848316-11848338 GTTTTAAAAAAGTTAAAATGAGG - Intergenic
1186783098 X:12933192-12933214 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1186867293 X:13733490-13733512 GTTGGAAACAATGGAAAAGGAGG - Intronic
1186913042 X:14190157-14190179 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1187620311 X:21045713-21045735 ATTCCAAACAATTGAAAAAGAGG - Intergenic
1188229548 X:27644714-27644736 GGTCCAAACAATTGAAAAGGAGG + Intronic
1188744507 X:33826289-33826311 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1188768368 X:34124790-34124812 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1188785726 X:34344054-34344076 ATTCCAAACAATTGAAAAGGGGG + Intergenic
1189749112 X:44201540-44201562 GTTATAAAAAATTTAAAATTAGG + Intronic
1189768189 X:44393610-44393632 TTTCAAATCAATTTTAAAGGAGG - Intergenic
1190530007 X:51365233-51365255 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1190531164 X:51378069-51378091 GTTCTAGACTATATAAAAAGGGG - Intergenic
1190901671 X:54680503-54680525 TTTCCAAACAATTGAAAAGGAGG + Intergenic
1190972127 X:55360105-55360127 ATTCAAAGCAATTGAAAAGGAGG + Intergenic
1190977440 X:55419828-55419850 CTTCTAAACAATTGCAAAGAAGG + Intergenic
1191064524 X:56333600-56333622 ATTCTAAACAATTGATATGGAGG - Intergenic
1191071665 X:56407253-56407275 ATTCTAAACAATGGAAAAAGAGG - Intergenic
1191115715 X:56850432-56850454 GTTCCAAACAATAGAAAAAGAGG + Intergenic
1191132274 X:57027241-57027263 ATTTAAAACAATTGAAAAGGAGG - Intergenic
1191186383 X:57617333-57617355 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1191595783 X:62942866-62942888 GTTCCAAACAATTGAAAACAAGG - Intergenic
1191651288 X:63540614-63540636 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1191651450 X:63542538-63542560 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1191676969 X:63801349-63801371 ATTCCAAACAATATAAAAAGAGG + Intergenic
1191746098 X:64488979-64489001 ATTCCAAGCAATTGAAAAGGAGG - Intergenic
1191766251 X:64701737-64701759 ATTACAAACAATTGAAAAGGAGG - Intergenic
1191771278 X:64761576-64761598 ATTCCAAACAATAGAAAAGGAGG - Intergenic
1191809216 X:65168576-65168598 GTTCCAAACAATAGAAAAAGAGG - Intergenic
1192018868 X:67362603-67362625 ATTCTAAACAATAAAAAAGAGGG + Intergenic
1192063899 X:67860953-67860975 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1192277174 X:69645136-69645158 ATTCCAAACAATTGAAAAGGAGG - Intronic
1192702037 X:73484719-73484741 ATTCCAAACAACTTAAAAAGAGG + Intergenic
1192702558 X:73491062-73491084 ATTCCAAAAAATTGAAAAGGAGG - Intergenic
1192716753 X:73650796-73650818 ATTCCAAAAAATTGAAAAGGAGG + Intronic
1192841674 X:74863716-74863738 ATTCTAAACAATTGAAAAGGAGG + Intronic
1192922445 X:75721157-75721179 GTTCCAAACAATAAAAAAAGAGG - Intergenic
1193009717 X:76662806-76662828 ATTCCAAACAATTGAAAAAGAGG - Intergenic
1193217277 X:78878479-78878501 ATTCCAAACAATTGAAAGGGAGG + Intergenic
1193309550 X:79989467-79989489 ATTCCAAACCATTGAAAAGGAGG + Intergenic
1193364813 X:80619694-80619716 GTTCCAAACAAAAGAAAAGGAGG - Intergenic
1193400576 X:81037159-81037181 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1193495523 X:82206609-82206631 ACTCCAAACAATTGAAAAGGAGG + Intergenic
1193504573 X:82326324-82326346 ATTCCAAACAATTTAAAAGGAGG + Intergenic
1193555428 X:82948166-82948188 ATTCCAAATAATTAAAAAGGAGG + Intergenic
1193605589 X:83564263-83564285 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1193625682 X:83817773-83817795 ATTCCAAACAATTGAAGAGGAGG - Intergenic
1193687465 X:84595109-84595131 ATTCCATACAATTGAAAAGGAGG + Intergenic
1193719154 X:84967912-84967934 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1193768214 X:85557955-85557977 ATTCCAAAGAATTGAAAAGGAGG - Intergenic
1193780499 X:85695719-85695741 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1193793556 X:85845927-85845949 ATTCCAAAAAACTTAAAAGGTGG + Intergenic
1193991362 X:88311942-88311964 ATTCCAAACAATCAAAAAGGAGG + Intergenic
1194021679 X:88699110-88699132 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1194066959 X:89272639-89272661 CTTCCAAAAAATTTAAAAGGAGG - Intergenic
1194170244 X:90572071-90572093 ATTCCAAACAATTGAAAAGAAGG + Intergenic
1194252176 X:91589426-91589448 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1194274358 X:91861013-91861035 GTTCCAAACAACTGAAAAGGAGG - Intronic
1194287126 X:92023620-92023642 ATTCCAAACAATTGTAAAGGAGG + Intronic
1194357026 X:92898191-92898213 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1194375962 X:93134125-93134147 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1194418791 X:93646960-93646982 ATTCCAAACAATTGAAAAGTAGG - Intergenic
1194436873 X:93877295-93877317 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1194489944 X:94533497-94533519 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1194517795 X:94878357-94878379 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1194580900 X:95669406-95669428 ATTTCAAACAATTGAAAAGGAGG + Intergenic
1194597042 X:95871223-95871245 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1194608308 X:96008660-96008682 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1194827564 X:98581558-98581580 GTTCTTGCCAATTTAAAATGAGG - Intergenic
1194854213 X:98908523-98908545 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1194895954 X:99440016-99440038 GTTCCAAAGAATCTAGAAGGAGG + Intergenic
1194905350 X:99569067-99569089 ATTCCAAACAATATAAAAAGAGG - Intergenic
1194911170 X:99646446-99646468 ATTCCAAACAATTGAAAAGAAGG - Intergenic
1195198571 X:102523547-102523569 ATTCCCAACAATTGAAAAGGAGG + Intergenic
1195212738 X:102666127-102666149 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1195434250 X:104824425-104824447 ATTCCAAACAATTGAAAAAGAGG - Intronic
1195494681 X:105516889-105516911 GTCCTAAACGATTTTAGAGGAGG + Intronic
1195644136 X:107209192-107209214 GTTCTCAAGAATTTTAATGGAGG + Intronic
1195649477 X:107270161-107270183 CTTCTAAACAATAGAAAAGAAGG + Intergenic
1195685946 X:107585978-107586000 ATTCCAAAAAATTGAAAAGGAGG - Intronic
1195812083 X:108845335-108845357 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1195813077 X:108855425-108855447 ATTCAAAACAATTGAAAAAGAGG + Intergenic
1195852674 X:109300236-109300258 TTTCTAAATAATTAAACAGGAGG + Intergenic
1195924767 X:110014514-110014536 GATTTAAAGAATTTAGAAGGTGG + Intronic
1195985913 X:110629916-110629938 ATTCTAAACAATAGAAAAAGAGG + Intergenic
1195988072 X:110654032-110654054 ATTCCAAACAATTAAAAAGAAGG + Intergenic
1196132389 X:112171291-112171313 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1196284142 X:113860287-113860309 ATTCCAAACAATTAAAAAGGTGG - Intergenic
1196382105 X:115101820-115101842 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1196532021 X:116799237-116799259 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1196606944 X:117668043-117668065 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1197029773 X:121799675-121799697 ATTCCAAACAATTGAAAAAGAGG - Intergenic
1197046105 X:122000570-122000592 ATTCCAAACAACTGAAAAGGAGG - Intergenic
1197049242 X:122039221-122039243 ATTCCAAACAATTAAAAAGGAGG - Intergenic
1197051567 X:122064985-122065007 ATTCCAAACAATTAAAAAGGAGG + Intergenic
1197061992 X:122192158-122192180 ATTCCAAATAATTGAAAAGGAGG - Intergenic
1197183841 X:123564214-123564236 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1197388602 X:125831685-125831707 ATTCTAAACAATTGAGGAGGAGG + Intergenic
1197455969 X:126675702-126675724 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1197516272 X:127433786-127433808 ATTTCAAACAATTGAAAAGGAGG - Intergenic
1197553118 X:127919213-127919235 ATTCTAAACAATTGAGCAGGAGG - Intergenic
1197606719 X:128593930-128593952 GTTCCAAACAACTAAAAAGGAGG - Intergenic
1197785778 X:130195471-130195493 GTTTTGAATAATTTAAAAGAAGG - Intergenic
1198361546 X:135900525-135900547 ATTCCAAAAAATTAAAAAGGAGG - Intronic
1198578925 X:138042102-138042124 ATTCCAAAAAATTAAAAAGGAGG + Intergenic
1199307915 X:146289427-146289449 ATTCCAAACAATTAAAAACGGGG - Intergenic
1199401796 X:147406987-147407009 ATTCCAAAGAATTGAAAAGGAGG + Intergenic
1199479030 X:148277306-148277328 ATTCCAAAAAATTGAAAAGGAGG + Intergenic
1199567092 X:149226950-149226972 ATTCTAAACAATTGAAAAGGAGG - Intergenic
1200321232 X:155192206-155192228 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1200516491 Y:4149837-4149859 ATTCCAAACAATTGAAAAGAAGG + Intergenic
1200571105 Y:4830666-4830688 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1200591595 Y:5082419-5082441 GTTCCAAACAACTGAAAAGGAGG - Intronic
1200604666 Y:5248182-5248204 ATTCCAAACAATTGTAAAGGAGG + Intronic
1200665359 Y:6015186-6015208 ATTCCAAACAATTGAAAAGGAGG + Intergenic
1200721119 Y:6606801-6606823 CTTCCAAAAAATTTAAAAGGAGG - Intergenic
1200741641 Y:6860561-6860583 ATTCCAAATAATTAAAAAGGAGG - Intergenic
1201590985 Y:15614487-15614509 ATTCTAAGCAATTAAAAAGAGGG + Intergenic
1201705471 Y:16931951-16931973 ATTCTAAACAATAGAAAAAGAGG + Intergenic
1201955720 Y:19620243-19620265 ATTTCAAACAATTAAAAAGGAGG - Intergenic
1202070055 Y:20982234-20982256 ATTCCAAACAATTGAAAAGGAGG - Intergenic
1202091995 Y:21201044-21201066 GTTCCAAACAATAGAAAAAGAGG - Intergenic