ID: 978982699

View in Genome Browser
Species Human (GRCh38)
Location 4:114969011-114969033
Sequence GAGCCATGACTCTAGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978982699 Original CRISPR GAGCCATGACTCTAGACCAG TGG (reversed) Intronic
900994281 1:6112069-6112091 GTCCCAGGAGTCTAGACCAGTGG - Intronic
904227144 1:29031473-29031495 GAACCACTACTCTAGGCCAGTGG - Intronic
904254795 1:29248095-29248117 GGACCATGACTCCAGCCCAGAGG - Intronic
906279938 1:44546273-44546295 GAGCCATGGCTCTGGGCCTGGGG - Intronic
909495457 1:76272635-76272657 GACCCATCACGCTACACCAGTGG - Intronic
915657804 1:157376214-157376236 GAGCCATGACTCTCGCCTGGTGG + Intergenic
915677196 1:157542807-157542829 GAGGCAGGACTCTTGGCCAGGGG + Intronic
916192998 1:162197392-162197414 GAGCCAGGATTATAGAACAGAGG + Intronic
916808162 1:168280408-168280430 GAGCCCTGACCCTTGAGCAGTGG + Intergenic
918190482 1:182169372-182169394 GAGCCTTGCCTGTAGACCCGTGG - Intergenic
919276799 1:195428690-195428712 GAGCCATAACTCTAACCAAGTGG + Intergenic
922843352 1:228662973-228662995 GGTGGATGACTCTAGACCAGAGG + Intergenic
923439852 1:234006916-234006938 GAACCTTTATTCTAGACCAGCGG + Intronic
1063071497 10:2671159-2671181 GAGCCAGGCCTATAGACCATGGG - Intergenic
1065637319 10:27745014-27745036 GAGTCTTGACTGTAGAACAGGGG - Intronic
1068461732 10:57337886-57337908 GAACCATGACTCTACAGCAATGG + Intergenic
1069359140 10:67622031-67622053 AAACTCTGACTCTAGACCAGTGG - Intronic
1070145178 10:73768779-73768801 GTGACATGACTCTGGACCTGGGG + Intronic
1070186020 10:74063180-74063202 GAGCCATGACACCAGGCCCGAGG + Intronic
1074851088 10:117440204-117440226 GAGCTATCACTCTAGAGAAGTGG - Intergenic
1077225835 11:1438773-1438795 GAGCCATGTCTCTATCCCTGAGG + Intronic
1081648036 11:44803521-44803543 GAGCCATATCTCCAGACCACTGG - Intronic
1081796027 11:45820527-45820549 GAGGGATGACTTTAGATCAGAGG + Intergenic
1083265319 11:61544177-61544199 GCCCCATGGCCCTAGACCAGAGG - Intronic
1084062779 11:66686915-66686937 GAGCCATGAGTCAGGTCCAGAGG - Intronic
1084512626 11:69615727-69615749 GAGCCTGGACTCTGGACCAGGGG + Intergenic
1085430350 11:76442795-76442817 GAGCCTATGCTCTAGACCAGTGG - Intergenic
1091846249 12:3658276-3658298 GGGCCATGACTATAGGTCAGAGG - Intronic
1093710840 12:22328155-22328177 GAGCTCTTACTCTAGAGCAGAGG - Intronic
1096685834 12:53287809-53287831 CAGCCAACACTCTAGATCAGGGG - Intronic
1096760016 12:53833600-53833622 GAGGCCTGACCCTAGACCAGGGG + Intergenic
1100192574 12:92208682-92208704 TAGTAATCACTCTAGACCAGAGG - Intergenic
1102218241 12:111177078-111177100 GACCCAAAACTCTAGAACAGTGG - Intronic
1104967318 12:132514116-132514138 GAGCCCTGACGCGAGAACAGAGG - Intronic
1106236806 13:27869052-27869074 GAGACCAGACTCCAGACCAGAGG - Intergenic
1108579317 13:51815203-51815225 GAGCCATGGCAGAAGACCAGCGG - Intergenic
1117059945 14:51951899-51951921 GAACCATCGCTGTAGACCAGGGG - Intronic
1117504832 14:56391640-56391662 GAGCCATGACTCAACACAATTGG + Intergenic
1120863292 14:89274192-89274214 GTGCCAGGACTCCAGACCAGAGG + Intronic
1121783957 14:96640566-96640588 GAGCCATGACTCTGGGCCCATGG - Intergenic
1121881335 14:97503026-97503048 GTCCCAGGACTCTAGACCAGTGG + Intergenic
1122060669 14:99134714-99134736 GAGGCATGACTGGAGTCCAGTGG - Intergenic
1125464984 15:39941855-39941877 GTGCCATGATTCTTAACCAGGGG - Intronic
1127662698 15:61115128-61115150 GACCCAAGACTCTAAACCCGTGG - Intronic
1129683275 15:77670613-77670635 GGGCCATGGCTCTGGACCAGAGG - Intronic
1131111315 15:89766860-89766882 GAGCCAGGACTCCAGCCCACTGG - Intronic
1131967933 15:97865347-97865369 GAGCCATGACTCCAGACTCCTGG + Intergenic
1136124059 16:28163721-28163743 GGGCCAAGACTCCAAACCAGGGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137649084 16:50103677-50103699 GAGCCACTGCTCTAGACTAGAGG + Intronic
1139834961 16:69830827-69830849 GAGCCTTCTCTCTAGACCTGGGG + Intronic
1142265955 16:89064051-89064073 GAGCCCTGACTCTGACCCAGGGG + Intergenic
1145037921 17:19554043-19554065 GAGACAGGACTGTAGGCCAGTGG + Intronic
1146660509 17:34662540-34662562 GAGTCATGAGTCAAGACCAAGGG - Intergenic
1146803237 17:35844325-35844347 GTGCAATGAGCCTAGACCAGAGG + Exonic
1147646377 17:42036771-42036793 CAGCAAGGACTCAAGACCAGAGG + Intronic
1148863760 17:50618153-50618175 GAGCCAGGGCTGGAGACCAGGGG + Intronic
1149933013 17:60774653-60774675 TAGCCATTAGTCTAGAGCAGGGG + Intronic
1152225518 17:79090972-79090994 GCGCCAGGACTTTAGGCCAGGGG - Intronic
1157490302 18:48119196-48119218 GAACCATGACTCTACACTAAAGG + Intronic
1159084766 18:63776120-63776142 GCGCCATGACCCTATCCCAGAGG + Intronic
1165738777 19:38193619-38193641 CAGCCCTGGCTCTAGGCCAGCGG - Exonic
1167661002 19:50796079-50796101 GAACCACGACTCTAACCCAGTGG + Intergenic
927023304 2:19040224-19040246 ATGCCTGGACTCTAGACCAGTGG - Intergenic
929469811 2:42180281-42180303 GAAACATGTCTCTGGACCAGAGG + Intronic
933198647 2:79422284-79422306 GAGCAGTGGCTCTAAACCAGGGG + Intronic
938905319 2:135831137-135831159 TAGCCATTGCTTTAGACCAGTGG - Intronic
939964115 2:148593745-148593767 GAGCCTTGGCTCTAGATCAGTGG + Intergenic
941638504 2:167961946-167961968 GGGCTTTGAGTCTAGACCAGGGG - Intronic
943990375 2:194682321-194682343 GAATGATGACTCTAGACCTGTGG - Intergenic
944992742 2:205256201-205256223 GAGCCATGACTATTGATCAAAGG - Intronic
1173445636 20:43115486-43115508 GAGCCATGGTTCTCAACCAGGGG + Intronic
1173904601 20:46616928-46616950 GAGCCAAGACTCAAGAGGAGAGG - Intronic
1174486568 20:50865242-50865264 GAGTCAGGACTCTAGGACAGAGG + Intronic
1175811485 20:61860772-61860794 GGGCCATTACTCTAGACGGGAGG - Intronic
1177083694 21:16675257-16675279 TAGCCATGACTATAGCCAAGGGG - Intergenic
1178344155 21:31810772-31810794 GAGCCAGGACTGCAGATCAGAGG - Intergenic
1178405384 21:32319115-32319137 CAGTCATGACTCTGTACCAGGGG - Intronic
1179036980 21:37766689-37766711 GATCACTGAATCTAGACCAGGGG + Intronic
1182762477 22:32733989-32734011 GAGCCAAGACTCTAAAGGAGAGG + Intronic
950006197 3:9692593-9692615 GATGCATGACTCCAGAGCAGAGG - Intronic
950258309 3:11523948-11523970 GCGCAATGGCTCTAGACAAGGGG - Intronic
950883930 3:16346612-16346634 CAACCATGACTCTTGACAAGTGG + Intronic
950896543 3:16456880-16456902 CAGACATGACTCTAGGTCAGTGG - Intronic
951619214 3:24582713-24582735 GAGGCATGAGTCTAGACAATGGG - Intergenic
951681598 3:25300703-25300725 GAGCCACCACTCCTGACCAGTGG - Intronic
954104481 3:48402560-48402582 GAGCCATGCCTCTGTTCCAGAGG - Intergenic
954232536 3:49228376-49228398 CAGCCATGTCTTTAGTCCAGCGG + Intronic
954287383 3:49628768-49628790 GAGCTGTGGATCTAGACCAGTGG + Intronic
955209716 3:56929257-56929279 GAGCCATGACTCTAGCCACTTGG - Intronic
955495082 3:59522580-59522602 GAGCTATGACACTGGACCAAAGG + Intergenic
955589265 3:60516499-60516521 GAGTCCTTTCTCTAGACCAGTGG - Intronic
957616070 3:82529039-82529061 GAGACATGGCTCTAGACTAAAGG + Intergenic
957769881 3:84676817-84676839 AAGCCATGATTTTAGAACAGTGG - Intergenic
959013464 3:101106572-101106594 TAGACTTGACTCTGGACCAGTGG + Intergenic
959378582 3:105614606-105614628 GAGTCTTCACTCTAGACAAGAGG - Intergenic
964501394 3:157351974-157351996 GAGCAATTATTCTAAACCAGAGG - Intronic
968074272 3:195807995-195808017 GGGCCATGGCCCTAGAGCAGGGG - Intronic
970537765 4:17046845-17046867 GAGCCATGAGTATTGATCAGGGG - Intergenic
974533433 4:63143367-63143389 GAGCCATGTTTCAAGACCACAGG + Intergenic
975809876 4:78156501-78156523 GAGCCAGCCCTCTGGACCAGAGG + Intronic
977516142 4:98023327-98023349 CAGCGATGACTGTAGAACAGCGG + Intronic
978924583 4:114227534-114227556 TTTCCATGACTCTATACCAGTGG + Intergenic
978982699 4:114969011-114969033 GAGCCATGACTCTAGACCAGTGG - Intronic
981416812 4:144503433-144503455 CAGCCATCTCTCTAAACCAGGGG - Intergenic
986122374 5:4853479-4853501 GAGTCATTGCTTTAGACCAGTGG + Intergenic
986363662 5:7007336-7007358 GAACCATTCTTCTAGACCAGGGG + Intergenic
987088587 5:14491096-14491118 GGGCTATGAATCTAGACCTGTGG - Intronic
989122147 5:38015596-38015618 CCTCCATGCCTCTAGACCAGTGG - Intergenic
995534217 5:113119352-113119374 GAGGCATGACTCTAGAGGGGAGG + Intronic
995944128 5:117621962-117621984 CAGCCATGATTCCTGACCAGTGG - Intergenic
997480014 5:134177722-134177744 GAGCCATCTCTCTAGACTTGGGG - Intronic
998775880 5:145601640-145601662 AAGACATGAATCTAGACAAGTGG + Intronic
1004173325 6:13316219-13316241 GAGGGATTACTCTAGACCAGCGG + Intronic
1006619943 6:35356755-35356777 GAGCAGTGACTCTCAACCAGGGG - Intronic
1007388989 6:41538995-41539017 GAGCCATGGCTCAAGAGCAGAGG + Intergenic
1007601842 6:43087057-43087079 GAAACATGACTTTAGAACAGAGG - Intronic
1011636710 6:89381329-89381351 GGGCAATTCCTCTAGACCAGGGG - Intronic
1016635945 6:146290503-146290525 GAGCCAAGTCTCATGACCAGAGG + Intronic
1019261345 7:83725-83747 GAGTCAGGAGTCAAGACCAGAGG + Intergenic
1021421019 7:20444665-20444687 GACCCATGACTCAAGACAACTGG + Intergenic
1022411149 7:30139626-30139648 GAGCAAGGACTTGAGACCAGAGG + Intronic
1023825206 7:44004339-44004361 GTGCCAAGACTCAAGACCATGGG - Intronic
1026088755 7:67283110-67283132 GTGCCAAGACTCAAGACCATGGG - Intergenic
1026465898 7:70654225-70654247 TAACCATTACTCTAAACCAGGGG + Intronic
1026725497 7:72867232-72867254 GTGCCAAGACTCAAGACCATGGG + Intergenic
1026747587 7:73025089-73025111 GTGCCAAGACTCAAGACCATGGG + Intergenic
1026751237 7:73053228-73053250 GTGCCAAGACTCAAGACCATGGG + Intergenic
1026754886 7:73081342-73081364 GTGCCAAGACTCAAGACCATGGG + Intergenic
1026758538 7:73109376-73109398 GTGCCAAGACTCAAGACCATGGG + Intergenic
1027033794 7:74910382-74910404 GTGCCAAGACTCAAGACCATGGG + Intergenic
1027088867 7:75284109-75284131 GTGCCAAGACTCAAGACCATGGG - Intergenic
1027092510 7:75312037-75312059 GTGCCAAGACTCAAGACCATGGG - Intergenic
1027096153 7:75340004-75340026 GTGCCAAGACTCAAGACCATGGG - Intergenic
1027118348 7:75498428-75498450 GTGCCAAGACTCAAGACCATGGG - Intergenic
1027323188 7:77027688-77027710 GTGCCAAGACTCAAGACCATGGG + Intergenic
1029057183 7:97759147-97759169 AAGACATTACTCTAGGCCAGTGG - Intergenic
1029397155 7:100316274-100316296 GTGCCAAGACTCAAGACCATGGG - Intronic
1029719142 7:102351593-102351615 GTGCCAAGACTCAAGACCATGGG + Intergenic
1029753471 7:102557666-102557688 GTGCCAAGACTCAAGACCATGGG - Intronic
1029771420 7:102656750-102656772 GTGCCAAGACTCAAGACCATGGG - Intronic
1037716038 8:21401027-21401049 GAGGCAGGACTCTACTCCAGAGG - Intergenic
1040370316 8:46764452-46764474 AAGACATTACTCTAGGCCAGTGG + Intergenic
1041794848 8:61736501-61736523 TAGCTATGACTGTAGAACAGGGG + Intergenic
1047678696 8:127231242-127231264 AAGAAATGGCTCTAGACCAGCGG + Intergenic
1049701681 8:144017419-144017441 GGGCCAGGTCTCTGGACCAGGGG - Intronic
1052060103 9:23949523-23949545 AAGCCTTGACTCTAGATCAGGGG + Intergenic
1052697594 9:31898182-31898204 GAGCCAAGGCTCTAAACCTGCGG - Intergenic
1056017082 9:82401309-82401331 GAGCCATGACGCCAGGCCAAGGG - Intergenic
1059676403 9:116544728-116544750 GGGCCAGGCCTCTAGACCACAGG + Intronic
1060776675 9:126379779-126379801 GAGCCAGGACCCCAGCCCAGTGG - Intronic
1061945593 9:133906833-133906855 GACCCATGGCTCTACACCGGGGG + Intronic
1186296731 X:8156593-8156615 GATTCATGACTCTAATCCAGAGG + Intergenic
1186573388 X:10739426-10739448 GAGCCTTTTCTCTAGTCCAGTGG + Intronic
1188935204 X:36167321-36167343 GATCCATGACTCTAGAGCTAGGG + Intergenic
1189671984 X:43420701-43420723 GACCCATGACTCTAGATTTGTGG - Intergenic
1197695052 X:129540787-129540809 GCGCCCTGACCCTAGCCCAGAGG + Exonic
1198175246 X:134148412-134148434 GAGACAGGACTCTACTCCAGAGG + Intergenic
1200842232 Y:7794325-7794347 CAGACATGACTCTAGTCCAGTGG - Intergenic
1201049616 Y:9918984-9919006 GAGCCCTGGCCCTAGTCCAGTGG - Intergenic