ID: 978985382

View in Genome Browser
Species Human (GRCh38)
Location 4:115005736-115005758
Sequence AGTTAGCTGGATAAGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2354
Summary {0: 1, 1: 0, 2: 8, 3: 138, 4: 2207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978985377_978985382 11 Left 978985377 4:115005702-115005724 CCAAGAGATAAGTGAGATCTGAA 0: 1
1: 0
2: 1
3: 14
4: 218
Right 978985382 4:115005736-115005758 AGTTAGCTGGATAAGATGGTGGG 0: 1
1: 0
2: 8
3: 138
4: 2207
978985376_978985382 25 Left 978985376 4:115005688-115005710 CCTAGAGGTGGTGACCAAGAGAT 0: 1
1: 0
2: 3
3: 11
4: 124
Right 978985382 4:115005736-115005758 AGTTAGCTGGATAAGATGGTGGG 0: 1
1: 0
2: 8
3: 138
4: 2207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978985382 Original CRISPR AGTTAGCTGGATAAGATGGT GGG Intronic
Too many off-targets to display for this crispr