ID: 978985382 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:115005736-115005758 |
| Sequence | AGTTAGCTGGATAAGATGGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2354 | |||
| Summary | {0: 1, 1: 0, 2: 8, 3: 138, 4: 2207} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 978985377_978985382 | 11 | Left | 978985377 | 4:115005702-115005724 | CCAAGAGATAAGTGAGATCTGAA | 0: 1 1: 0 2: 1 3: 14 4: 218 |
||
| Right | 978985382 | 4:115005736-115005758 | AGTTAGCTGGATAAGATGGTGGG | 0: 1 1: 0 2: 8 3: 138 4: 2207 |
||||
| 978985376_978985382 | 25 | Left | 978985376 | 4:115005688-115005710 | CCTAGAGGTGGTGACCAAGAGAT | 0: 1 1: 0 2: 3 3: 11 4: 124 |
||
| Right | 978985382 | 4:115005736-115005758 | AGTTAGCTGGATAAGATGGTGGG | 0: 1 1: 0 2: 8 3: 138 4: 2207 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 978985382 | Original CRISPR | AGTTAGCTGGATAAGATGGT GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||