ID: 978987241

View in Genome Browser
Species Human (GRCh38)
Location 4:115028288-115028310
Sequence CAGGATAAACACTCTTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978987239_978987241 19 Left 978987239 4:115028246-115028268 CCACGAATGTCTGGTTGTATCAA 0: 1
1: 0
2: 0
3: 5
4: 63
Right 978987241 4:115028288-115028310 CAGGATAAACACTCTTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978987241 Original CRISPR CAGGATAAACACTCTTAACA AGG Intronic
No off target data available for this crispr