ID: 978987681

View in Genome Browser
Species Human (GRCh38)
Location 4:115034324-115034346
Sequence TAATACCTACAGCAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978987681_978987685 20 Left 978987681 4:115034324-115034346 CCTTCCACTTGCTGTAGGTATTA 0: 1
1: 0
2: 0
3: 11
4: 112
Right 978987685 4:115034367-115034389 TGATCTCATCTGTCAGTGTCAGG 0: 1
1: 0
2: 2
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978987681 Original CRISPR TAATACCTACAGCAAGTGGA AGG (reversed) Intronic
901915518 1:12496590-12496612 TAATAAGTACAGCAAGTACAAGG + Intronic
902465609 1:16616092-16616114 TAATACCTACCCCATGAGGACGG - Intergenic
904690234 1:32288283-32288305 TAAGACCAACAGGGAGTGGAGGG - Intergenic
905431675 1:37929084-37929106 TAATACCTACAGTAAGTGACTGG - Intronic
908200656 1:61792146-61792168 GCATACTTACAGCAGGTGGAAGG + Intronic
910198339 1:84669497-84669519 TAATACCTACAGTATATTGAAGG - Intronic
910628568 1:89334588-89334610 TCGTACCTAGAGCAGGTGGAAGG + Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911347302 1:96712250-96712272 TAAAGCCTACAGAAAGAGGAAGG - Intergenic
913133864 1:115868210-115868232 GATTACTTACAGAAAGTGGATGG - Intergenic
913599876 1:120413054-120413076 AAAAACCTAAAGCAAATGGAAGG - Intergenic
914087184 1:144463621-144463643 AAAAACCTAAAGCAAATGGAAGG + Intergenic
914192967 1:145426712-145426734 AAAAACCTAAAGCAAATGGAAGG + Intergenic
914311425 1:146470587-146470609 AAAAACCTAAAGCAAATGGAAGG - Intergenic
914590993 1:149105507-149105529 AAAAACCTAAAGCAAATGGAAGG + Intergenic
918816466 1:189191751-189191773 AAATGGCTACAGAAAGTGGATGG - Intergenic
921045496 1:211474204-211474226 TAATGCTGACAGCATGTGGAAGG + Intergenic
922169906 1:223145175-223145197 GAAGACCTTAAGCAAGTGGAAGG - Intergenic
922480633 1:225938144-225938166 GAGGACCTACAGCCAGTGGAAGG + Intronic
922823711 1:228502588-228502610 TACCACCAACAGCAATTGGATGG - Intergenic
923233468 1:232010273-232010295 TACCACCTGCTGCAAGTGGATGG + Intronic
923291098 1:232547089-232547111 TAATACCATAAGGAAGTGGATGG + Intronic
923914857 1:238491243-238491265 TAATATCTACAATAAGTGCAGGG + Intergenic
1064514902 10:16136553-16136575 TAATACCTACACCTAGGTGATGG - Intergenic
1065112899 10:22457362-22457384 TAATAAATAAAGCATGTGGAGGG + Intergenic
1068939810 10:62669760-62669782 CATTACCCACAGCAAGTCGAGGG + Intronic
1073185560 10:101613327-101613349 TAATCCCTGCAGCCAGGGGATGG + Intronic
1074701813 10:116098962-116098984 TATGACCCACAGCCAGTGGATGG + Intronic
1076038126 10:127218679-127218701 AAATAACAACAGAAAGTGGAGGG - Intronic
1077079084 11:715569-715591 TAAAACCCACAGTAAGTGGAAGG - Intronic
1085364477 11:75926960-75926982 TAATCCTTAAAGCAAGTGTATGG + Intronic
1086337249 11:85811683-85811705 TAATACCTAGAGAAAGGTGAGGG + Intergenic
1087609588 11:100417913-100417935 TAATTCCTACATCAAGAGAAGGG + Intergenic
1097624448 12:61982853-61982875 TATTCCCACCAGCAAGTGGAAGG + Intronic
1100714955 12:97295819-97295841 TCATGCCTACAGCATGAGGAAGG - Intergenic
1101698971 12:107153793-107153815 TAGGACTTACAGGAAGTGGATGG - Intergenic
1107263591 13:38524742-38524764 CAATACATACAGTAAGTGCAGGG + Intergenic
1108673044 13:52711123-52711145 AAATACCTACAACAAGTTTATGG + Intronic
1110738886 13:78970930-78970952 TAATCACTGCAGCAAGAGGAAGG - Intergenic
1111667718 13:91290885-91290907 AAATTTCTACAGAAAGTGGAAGG - Intergenic
1116447260 14:45024231-45024253 TAATAACTTGAGAAAGTGGAGGG + Intronic
1126323953 15:47454980-47455002 TAATACCTACATCAAGGGAGTGG + Intronic
1134406114 16:13960169-13960191 GAATATCTACAGCAAGAGGAAGG - Intergenic
1141311945 16:82922530-82922552 TAATACATACAACAAGAAGAGGG - Intronic
1141384822 16:83611067-83611089 GAATCCCAACAGCCAGTGGATGG - Intronic
1141475953 16:84273616-84273638 TACTTCATACAGCAAGTGAAAGG + Intergenic
1150966652 17:69977574-69977596 AAACACCAACAGCAAGTGGAAGG - Intergenic
1153576016 18:6522785-6522807 TAATACCTACAGTAATTGAGAGG - Intronic
1162766758 19:12924521-12924543 TGATACCTGCAGGAAGTGGGGGG + Exonic
1162935874 19:13981231-13981253 TAATTCCCACAGCAAGCTGAGGG + Intronic
1163103369 19:15110141-15110163 TGCTGCCTACTGCAAGTGGATGG + Exonic
1164414900 19:28038793-28038815 TAATTCCTACAGGAAGAGTAAGG - Intergenic
1164519468 19:28967517-28967539 TAATTCCTACAGCAAGTGCGGGG - Intergenic
1164668665 19:30060856-30060878 TTATACTTACACCAAGTGGTTGG - Intergenic
1166588841 19:43976613-43976635 AAATAACTACAGCAATTAGAAGG - Intronic
927749797 2:25657460-25657482 TAATCCCAACAGGATGTGGAAGG + Intronic
929367911 2:41183286-41183308 AAATAGCTTCACCAAGTGGAGGG - Intergenic
931398595 2:61910095-61910117 TAAAAACTAGAGCAAGTGAATGG - Intronic
932145407 2:69311396-69311418 TAATACCTGTAACATGTGGAAGG - Intergenic
933176055 2:79174300-79174322 TAAATCCTACAGCTAATGGATGG - Intergenic
933306609 2:80608255-80608277 TAATATCTGCAGCAAGGTGAAGG + Exonic
934708989 2:96503137-96503159 TACTCCCTCCAGGAAGTGGATGG - Intronic
935512340 2:103991493-103991515 TAAAACCAACAGCAAGTGATTGG - Intergenic
939476539 2:142694498-142694520 TTATAGCTAAAGCAAGTGGGTGG - Intergenic
940198059 2:151118094-151118116 TAATACCCTCAACAAGTTGATGG + Intergenic
949015743 2:241709313-241709335 GAACGCCTACAGCAAGTGCAAGG + Exonic
1170062565 20:12274199-12274221 TAAAACCTAATGCAAGTAGAAGG + Intergenic
1173132780 20:40410255-40410277 TAATGCCTAAAGCAAGAGCAAGG + Intergenic
1173267374 20:41496928-41496950 TTGTACCTATAGCAAGAGGAAGG - Intronic
1177796164 21:25780489-25780511 TAATACCTACAGTCAATGAAAGG + Intergenic
950937113 3:16850427-16850449 AATTACCTACAGCAACAGGAAGG - Intronic
953203919 3:40803950-40803972 GAAAACCTAAAGCAAATGGAAGG + Intergenic
953490643 3:43347554-43347576 TAAAACCCACAGCCAGTGGGCGG + Exonic
953604178 3:44398858-44398880 TGATACATGCAGCAACTGGATGG + Intronic
954820505 3:53322556-53322578 TGATACACACAGCAAGTGAACGG + Intronic
956038239 3:65118681-65118703 TAATTCCTGAAGCAAATGGATGG - Intergenic
956782230 3:72613087-72613109 TAATCCCTACAGCAGGTGGGAGG + Intergenic
958599904 3:96283191-96283213 TAATAGCTACTGATAGTGGAAGG + Intergenic
961604719 3:128085161-128085183 TAATAACAACAGCAATGGGAAGG + Intronic
964080889 3:152755485-152755507 TAAAACCCACAGAAAGAGGAAGG + Intergenic
965196661 3:165606073-165606095 TAATACTTACAGAAATTGTAAGG + Intergenic
972123567 4:35736134-35736156 TAATATCCAAAGCAACTGGATGG + Intergenic
972841214 4:42932228-42932250 TAATGCATACATCAAGAGGAGGG - Intronic
977408392 4:96630554-96630576 TAATTACAACAGAAAGTGGAAGG + Intergenic
978987681 4:115034324-115034346 TAATACCTACAGCAAGTGGAAGG - Intronic
979094379 4:116527755-116527777 TAAGACTTGCAGCAACTGGAGGG + Intergenic
985760389 5:1745927-1745949 TAATGCCCCCACCAAGTGGACGG - Intergenic
990009807 5:50983278-50983300 TGATACCTATGGCAAGTGAAGGG - Intergenic
990445319 5:55888578-55888600 TAATCCATACAGCAAGTGTAAGG - Intronic
992197994 5:74358382-74358404 TAATTCTTACACCAAATGGATGG - Intergenic
992832033 5:80602761-80602783 TAAAACCTACAGCAACTATATGG - Intergenic
1003701967 6:8476472-8476494 TAACACCAACAGCAAGTTCAAGG + Intergenic
1005609555 6:27510553-27510575 TAATACCTTCAGCATGGGCAGGG - Intergenic
1008457782 6:51731491-51731513 TAATACCTCCTGCAAATGGCAGG + Intronic
1009728677 6:67569455-67569477 TTATGCATACAGCAAGTGGTTGG - Intergenic
1011220174 6:85046754-85046776 TAATAACACCAGCAAGTGTATGG - Intergenic
1013489403 6:110630599-110630621 AACTACAGACAGCAAGTGGAAGG - Intronic
1013587010 6:111588334-111588356 TAATACAGAGAGCAAGGGGATGG + Intronic
1014406220 6:121054642-121054664 TAATCGGTACAGCAAGTAGACGG + Intergenic
1016239236 6:141909122-141909144 TAATAACCACAACAAGGGGAGGG - Intergenic
1016648415 6:146435806-146435828 TATTTGCTACAGTAAGTGGAAGG - Exonic
1021506232 7:21388622-21388644 AAATTCCTACAGTAAGTGAATGG - Intergenic
1024601165 7:50982797-50982819 TATTACCTACTGCTTGTGGATGG - Intergenic
1027180584 7:75936623-75936645 CAATTCCTACAGCAAGTCCACGG - Intronic
1027783348 7:82548142-82548164 TAAAAGCAACAGGAAGTGGAAGG + Intergenic
1028904258 7:96135401-96135423 TAAGACCTAAAGGAAGTGGTGGG - Intronic
1031088993 7:117330126-117330148 TAATACATACAGGAAATGTATGG + Intergenic
1032459150 7:132096511-132096533 TAAAAACTACGGCAAGAGGAAGG - Intergenic
1034570789 7:151954660-151954682 AAATTCCTACAGCATGTGGAAGG - Intergenic
1037243051 8:16799475-16799497 TAATACCTTCTGCATGTGCAGGG + Intergenic
1037406897 8:18552385-18552407 TAAAAACAACAGCAACTGGAAGG - Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1046815651 8:118580834-118580856 TAATACCTTCAGCATGGGCAGGG + Exonic
1048308171 8:133297719-133297741 TGAGACCTACAGGAAGTGAAGGG - Intronic
1048546648 8:135393767-135393789 TAATACTTTCACCAGGTGGAGGG + Intergenic
1050719774 9:8574102-8574124 TAATACCTACAGATACTGCACGG + Intronic
1053436661 9:38080054-38080076 TAATACCTACAGCAATAGAAAGG + Intergenic
1057966534 9:99509280-99509302 TAATCTCTGCAGCATGTGGAAGG + Intergenic
1059743864 9:117181422-117181444 TAATACCTTCAACAAGTTTATGG - Intronic
1189765948 X:44372333-44372355 TCTTACCTAAAGTAAGTGGAGGG + Intergenic
1196667446 X:118331430-118331452 TGATACTTAGAGCAAGTGCATGG - Intergenic
1197730546 X:129805794-129805816 TAATAAATACAACAAGTGGAAGG + Exonic
1200893362 Y:8347121-8347143 TAAAACCTACATGAAGTGGTAGG - Intergenic
1201898001 Y:19014793-19014815 TAATACCTACAGAGGGAGGAAGG + Intergenic