ID: 978991245

View in Genome Browser
Species Human (GRCh38)
Location 4:115084710-115084732
Sequence CTTGATTTCTGTGTGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1167
Summary {0: 1, 1: 0, 2: 14, 3: 166, 4: 986}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978991245_978991246 14 Left 978991245 4:115084710-115084732 CCTGTTGGCACACAGAAATCAAG 0: 1
1: 0
2: 14
3: 166
4: 986
Right 978991246 4:115084747-115084769 AACCTCCGCCTATAATTCAGAGG 0: 1
1: 1
2: 140
3: 1315
4: 1701
978991245_978991250 22 Left 978991245 4:115084710-115084732 CCTGTTGGCACACAGAAATCAAG 0: 1
1: 0
2: 14
3: 166
4: 986
Right 978991250 4:115084755-115084777 CCTATAATTCAGAGGATGTATGG 0: 1
1: 34
2: 1363
3: 2212
4: 1655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978991245 Original CRISPR CTTGATTTCTGTGTGCCAAC AGG (reversed) Intronic
900730829 1:4258486-4258508 CTTGACTTCTGTGCACCCACAGG - Intergenic
900815401 1:4839795-4839817 CTTGACTTCTGTGTACCTATAGG + Intergenic
900820167 1:4880439-4880461 CTTAATTTCTTTGTGCCTCCGGG + Intergenic
903354875 1:22740564-22740586 CTGCATTTCTGAGTGCCATCTGG + Intronic
903645330 1:24892217-24892239 CTTGACTTCTGTGCACCCACAGG + Intergenic
904572039 1:31473488-31473510 CTTGACTTCTGTGTACCCACAGG + Intergenic
906017059 1:42591492-42591514 CTTGCATTCTATGTGCCCACAGG - Intronic
906833511 1:49059350-49059372 CTTGACTTCTGTGTACCCATAGG - Intronic
906938451 1:50235070-50235092 CTTGACTTCTGTGTACCTACAGG - Intergenic
907021031 1:51066983-51067005 CTTGACTTCTGTGTACCTGCAGG + Intergenic
907555897 1:55344070-55344092 CTTGACTTCTGTGCACCCACAGG - Intergenic
907586249 1:55620553-55620575 CTTGACTTCTGTGTACTCACAGG - Intergenic
907616770 1:55934131-55934153 CTTGATTTCTGTGCACCCAGAGG + Intergenic
908020006 1:59889466-59889488 CTTGACTTCTGTGCACCCACAGG + Intergenic
908118697 1:60965532-60965554 CTTGACTTCTGTGCACCTACAGG + Intronic
908400150 1:63765109-63765131 CTTGATTTCTTTTAGCCAAATGG + Intergenic
909192596 1:72573046-72573068 CTTGACTTCTGTGTACCCACAGG - Intergenic
909241688 1:73221774-73221796 CTTGACTTCTGTGTACCTGCAGG + Intergenic
909265273 1:73550125-73550147 CTTGACTTCTGTGCACCAACAGG + Intergenic
909700241 1:78513930-78513952 TTTGCATTCTGTGTGCCTACAGG - Intronic
909710849 1:78647526-78647548 CTTGCTCTCTGTGTACCCACAGG + Intergenic
909808816 1:79905793-79905815 CTTGACTTCTGTGTGCCCACAGG + Intergenic
910001766 1:82350281-82350303 CTTGACTTCTGTGTACCCATGGG + Intergenic
910064909 1:83141304-83141326 CTTGACTTCTGTGTACCAGAAGG - Intergenic
910141511 1:84031768-84031790 CTTGACTTCTGTGTACCCACAGG + Intergenic
910256131 1:85249054-85249076 CTTGACTTCTGTGTACCTGCAGG + Intergenic
910512905 1:88025867-88025889 CTTGACTTCTGTGAACCCACAGG + Intergenic
910726932 1:90349487-90349509 CTTGACTTCTGTGTACCCGCAGG - Intergenic
910793871 1:91078055-91078077 CTGGGTTTCTGTGAGCCAAAAGG + Intergenic
910817910 1:91312015-91312037 CTTGACTTCTGTGTACCCACAGG - Intronic
911011796 1:93288518-93288540 CTTGACTTCTGTGTACCTGCAGG - Intergenic
911149581 1:94584386-94584408 GTTTATTTCTCTGTGACAACAGG + Intergenic
911267682 1:95762335-95762357 CTTGACTTCTGTGCACCCACAGG + Intergenic
911790927 1:102014493-102014515 ATTGAGTTCTGTGTACCCACAGG - Intergenic
911799027 1:102110317-102110339 CTTGAGTTCTGTGCACCCACAGG + Intergenic
911972149 1:104452370-104452392 CTTAAATTCTGTGTACCCACAGG - Intergenic
912009954 1:104947358-104947380 CTTGACTTCTGTGCACCCACAGG - Intergenic
912065086 1:105728677-105728699 CTTGGTTTATGTGTTCCAAATGG - Intergenic
912084025 1:105976906-105976928 CTTGTCTTCTGTGTGCCCACAGG - Intergenic
912579144 1:110704602-110704624 CTTGATTTCTGTGCACCCACAGG + Intergenic
912735925 1:112149546-112149568 CTTGTCTTCTGTGTGCTCACAGG - Intergenic
913081852 1:115395519-115395541 CTTGATTTCTGTGCACCCGCAGG + Intergenic
913094474 1:115503327-115503349 CTTGATTTCTGTGCACCTGCAGG - Intergenic
913242057 1:116837932-116837954 CTTGATTTCTGTGCACCTGCAGG - Intergenic
913396361 1:118376539-118376561 TTTGATTTCTCTGTGCCTGCAGG + Intergenic
914351623 1:146844963-146844985 CTTGACTTCTGTGCACCCACAGG + Intergenic
914863042 1:151402134-151402156 CTTAATTTTTGTGTGCTAACTGG + Intergenic
916302793 1:163294317-163294339 CTTGTCTTCTGTGTACCCACAGG + Intronic
916446601 1:164878159-164878181 TTTGTTATCTGTGTGCCAAATGG + Intronic
916688894 1:167172232-167172254 CTTGACTTCTGTGTACCCACAGG - Intergenic
916814440 1:168337790-168337812 CTTGACTTCTGTGCACCCACAGG + Intergenic
916815172 1:168344698-168344720 CTAGATTTCTGTTTGCCAGAGGG + Intergenic
917290842 1:173470986-173471008 CTTGACTTTTGTGTGCCTACAGG - Intergenic
917894551 1:179475048-179475070 CTTGACTTCTGTGCACCCACAGG - Intronic
918727760 1:187947633-187947655 CTTGATTTCTGTGTACCTGCAGG - Intergenic
918788227 1:188792330-188792352 CTTGTTTTCTGTTTGACAATAGG - Intergenic
918831581 1:189405381-189405403 ATTGACTTCTGTGTGCTCACAGG + Intergenic
919011755 1:191974069-191974091 CTTGACTTCTGTGTACCTTCAGG + Intergenic
919256264 1:195128694-195128716 CTTGATTTCTGTGCACCCACAGG + Intergenic
919343475 1:196344478-196344500 CTTTATTTTTGTTTGCCAAAGGG - Intronic
919473792 1:198010317-198010339 CTTGATTTCTGTGCACCTGCAGG + Intergenic
919550908 1:198986150-198986172 CATGATTTTTGTGTGCCTAGTGG - Intergenic
919554304 1:199031673-199031695 CTTGACTTCTGTGTACCTGCAGG + Intergenic
919941536 1:202290253-202290275 CTTGCCTTCTGTGCACCAACAGG - Intronic
920594529 1:207255631-207255653 CTTGACTTCTGTGCACCTACAGG + Intergenic
920860318 1:209700315-209700337 CTTGATTTCTGTGCACCATGTGG + Intronic
921000581 1:211039229-211039251 CTTGATTTCTGTGTACCTGCAGG - Intronic
921282198 1:213578192-213578214 CTTGACTTCTGTGTAGCCACAGG - Intergenic
921452377 1:215324009-215324031 CTTGACTTCTGTGCACCCACAGG + Intergenic
921765963 1:218973029-218973051 CTTGACTTCTATGTACCCACAGG - Intergenic
921775671 1:219097062-219097084 CTTGATTTCTGTGTACCCACAGG - Intergenic
921880502 1:220249853-220249875 CTTGATTTCTATGCACCCACAGG - Intronic
922011086 1:221588195-221588217 CTTGATTTCTGTGCACCCACAGG - Intergenic
923428033 1:233891501-233891523 CTTGACTTCTGCGTACCCACAGG - Intergenic
924806585 1:247366427-247366449 CTTGACTTCTGTGCACCCACAGG - Intergenic
1064626509 10:17266851-17266873 CTTGACTTCTGTGCACCCACAGG - Intergenic
1064628165 10:17282684-17282706 CTTGACTTCTGTGCACCCACAGG - Intergenic
1065159903 10:22908858-22908880 CTTGACTTCTGTGCACCATCAGG + Intergenic
1065408134 10:25391066-25391088 CTTGACTTCTGTGCACCCACAGG - Intronic
1065456325 10:25910271-25910293 CTTGACTTCTGTGCACCTACAGG - Intergenic
1066161475 10:32736049-32736071 CTTGATTTCTGTAGGGCTACAGG + Intronic
1067573258 10:47386897-47386919 CTTGACTTCTGTGCACCCACAGG + Intergenic
1067918114 10:50422380-50422402 CTTGGGTTCTGCTTGCCAACTGG - Intronic
1068221543 10:54051996-54052018 CTTGACTTCTGTGCACCCACAGG - Intronic
1068252087 10:54455946-54455968 CTTGACTTCTGTGTACCTGCAGG - Intronic
1068399386 10:56508878-56508900 CTTGACTTCTGTGTACTAGCAGG - Intergenic
1068676838 10:59777666-59777688 CTTGACTTCTGTGTACCTGCGGG + Intergenic
1068908352 10:62351829-62351851 CTTGACTTCTGTGTGCTCGCAGG + Intergenic
1068972511 10:62974539-62974561 CTTGACTTCTGTGCGCCTGCAGG + Intergenic
1069095039 10:64249311-64249333 CTTGACTTCTGTGCACCCACAGG + Intergenic
1069804142 10:71107337-71107359 CTTGACTTCTGTGCACCCACAGG - Intergenic
1069808802 10:71143353-71143375 CTTGGTTCCTGTGTCCCAGCAGG - Intergenic
1070870080 10:79743848-79743870 CTTGACTTCTGTGCACCCACAGG - Intergenic
1071395402 10:85218628-85218650 CTTGACTTCTGTGCACCCACAGG - Intergenic
1071637002 10:87266068-87266090 CTTGACTTCTGTGCACCCACAGG - Intergenic
1071658242 10:87471886-87471908 CTTGACTTCTGTGCACCCACAGG + Intergenic
1071818290 10:89254307-89254329 CTTGACTTCTGTGCACCCACAGG + Intronic
1071873448 10:89819037-89819059 CTTGACTTCTGTGTGCCCACAGG + Intergenic
1072368966 10:94744660-94744682 CTTGACTTCTGTGCACCCACAGG - Intronic
1073153436 10:101327822-101327844 CTTGACTTCTGTGCACCCACAGG - Intergenic
1073841562 10:107504097-107504119 CTTGACTTCTGTGTACCCGCAGG + Intergenic
1073897919 10:108184513-108184535 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1073922124 10:108471013-108471035 CTTGACTTCTGTGTACTCACAGG + Intergenic
1073942386 10:108713543-108713565 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1074025242 10:109627239-109627261 CTTGACTTCTGTGCACCTACAGG + Intergenic
1074041419 10:109793341-109793363 CTTGACTTCTGTGTACCCACAGG + Intergenic
1074262729 10:111870394-111870416 CTTGACTTCTGTGTACCTCCAGG - Intergenic
1074640243 10:115371078-115371100 CTTGACTTCTGTGTACCCACAGG - Intronic
1074703087 10:116109582-116109604 CTTGACTTCTGGGTGCCCTCTGG - Intronic
1075233566 10:120706337-120706359 CTTCATTTCTGTGTGCTGACAGG + Intergenic
1075281660 10:121144000-121144022 CTTGACTTCTGTGCACCCACAGG + Intergenic
1075354264 10:121756611-121756633 CTTGACTTCTGTGCACCCACAGG + Intronic
1075937988 10:126359973-126359995 CTTGACTTCTGTGTACCCACAGG + Intronic
1076532121 10:131151860-131151882 CTTGACTTCTGTGTACCCAGAGG + Intronic
1076926814 10:133494903-133494925 CTTGACTTCTGTGTACCCACAGG + Intergenic
1077172507 11:1174243-1174265 CTTCATCTCTGTGACCCAACAGG - Intronic
1077199393 11:1297896-1297918 AGTGTTTCCTGTGTGCCAACAGG - Intronic
1077426218 11:2479428-2479450 CTTGACTTCTGTGCACCCACAGG + Intronic
1078308930 11:10219228-10219250 CTTGACTTTTGTGTACCCACAGG + Intronic
1078834892 11:15017696-15017718 CTTGCTTTATGTGTCCCCACAGG - Intronic
1079511492 11:21216178-21216200 CTTGACTTCTGTGCACCTACAGG - Intronic
1079521159 11:21328357-21328379 CTTGACTTCTGTGCACCTACAGG - Intronic
1079546825 11:21643164-21643186 CTTGACTTCTGTGTACCCACAGG - Intergenic
1079736207 11:23999882-23999904 TTTGACTTCTGTGTACCCACAGG + Intergenic
1079804315 11:24910601-24910623 CTTGACTTCTGTGTGCCCACAGG - Intronic
1079834988 11:25323128-25323150 CTTGACTTCTGTGTACCCACAGG - Intergenic
1079980844 11:27150069-27150091 CTTGCATTCTGTGTGCCCACAGG + Intergenic
1080088519 11:28315870-28315892 CTTGACTTCTGTGCACCCACAGG - Intronic
1080151451 11:29056850-29056872 CTTGACTTCTCTGTACCCACAGG - Intergenic
1080215192 11:29832133-29832155 CTTAACTTCTGTGTACCCACAGG - Intergenic
1080511472 11:32977727-32977749 TTTTATTTGTGTTTGCCAACAGG + Exonic
1080746048 11:35109584-35109606 CTTGAATTCTGTGTACCTACAGG - Intergenic
1080973324 11:37304146-37304168 CTTGACTTCTGTGGACCCACAGG + Intergenic
1081077683 11:38696558-38696580 CTTGACTTCTGTGGACCCACAGG + Intergenic
1081238904 11:40679674-40679696 CTTGACTTCTGTGTACTCACAGG - Intronic
1081285210 11:41260496-41260518 TTTGATTTCTGTATTCCACCTGG - Intronic
1081349120 11:42026998-42027020 CTTGACTTCTGTGCACCCACAGG + Intergenic
1081373630 11:42334009-42334031 CTTGACATCTGTGTACCCACAGG + Intergenic
1081388758 11:42503903-42503925 ATTGACTTCTGTGTACCCACAGG + Intergenic
1081479909 11:43476548-43476570 CTTGACTTCTGTGCACCCACAGG + Intronic
1081769028 11:45635890-45635912 CTTGACTTCTGTGCACCCACAGG - Intergenic
1082287782 11:50335568-50335590 CTTGACTTCTGTGCACCCACAGG + Intergenic
1082615058 11:55349440-55349462 CTTGACTTCTGTGCACCTACAGG - Intergenic
1082652086 11:55806270-55806292 CTTGACTTCTGTGTACCCACAGG + Intergenic
1082734273 11:56838924-56838946 CTTGACTTCTGTGTGTCTGCAGG + Intergenic
1083121875 11:60520977-60520999 CTTGACTTCTGTGTACCCGCAGG + Intronic
1085476379 11:76791745-76791767 CTTGACTTCTGTGTACCCACAGG - Exonic
1085593964 11:77791194-77791216 CTTGACTTCTGTGCACCCACAGG + Intronic
1086184968 11:84002514-84002536 CTTGACATCTGTGTACCCACAGG + Intronic
1086287965 11:85271259-85271281 CTTGACTTCTGTGTACCCATAGG - Intronic
1086309321 11:85518949-85518971 CTTGACTTCTGTGCACCCACAGG - Intronic
1086323262 11:85672090-85672112 CTTGACTTCTGTGCACCCACAGG + Intronic
1086765832 11:90693955-90693977 CCTGAATTCTGTGTACCCACAGG - Intergenic
1086936103 11:92747249-92747271 CTTGACTTCTGTGCACCCACAGG + Intronic
1087493847 11:98864062-98864084 CTTGACTTCTGTGCACCCACAGG + Intergenic
1087550213 11:99639104-99639126 CTTGACTTCTGTGTACCTTCAGG + Intronic
1087690684 11:101317549-101317571 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1087793642 11:102432928-102432950 CTTGACTTCTGTGCACCCACAGG - Intronic
1087831725 11:102826226-102826248 CTTGACTTCTCTGTACCCACAGG + Intergenic
1087877471 11:103375185-103375207 CTTGTTTTCTGTGCACCCACAGG - Intronic
1088014030 11:105037612-105037634 CTTGACTTCTGTGCCCCTACAGG - Intergenic
1088038785 11:105351005-105351027 CTTGACTTCTGTGTACCCACAGG + Intergenic
1088201565 11:107341163-107341185 TTTGATTTCTCTGTTCAAACTGG + Intronic
1088435241 11:109804937-109804959 CTTGACTTCTGTGTACTCACAGG + Intergenic
1088757128 11:112894718-112894740 CTTATGTTCTGTGTGCAAACTGG + Intergenic
1089806255 11:121093507-121093529 GTTGATTTCAGAGTGACAACTGG + Intergenic
1091982731 12:4879509-4879531 CTTGATTTCTGTGCACTTACAGG + Intergenic
1092502139 12:9058804-9058826 CTTGATTTCTGTGGACCAGGTGG - Intergenic
1092618185 12:10234560-10234582 CTTGACTTCTGTGCACCCACAGG + Intergenic
1092652217 12:10646919-10646941 CTTGACTTCTGTGTACCCACAGG - Intronic
1093682896 12:22023579-22023601 CTTGACTTCTGTGCACCTACAGG - Intergenic
1094489254 12:30948476-30948498 CTTGACTTCTGTGCACCCACAGG + Intronic
1095235008 12:39785379-39785401 CTTGACTTCTGTGCACCCACAGG - Intronic
1095530609 12:43182357-43182379 TTTGATTTCTGTGCTCCCACAGG + Intergenic
1095623214 12:44283042-44283064 CTTGACTTCTGTGTACCCACAGG - Intronic
1096263876 12:50109168-50109190 CTTGGATTTTCTGTGCCAACTGG - Intronic
1096960247 12:55570055-55570077 CTTGACTTCTGTGCTCCCACAGG + Intergenic
1097211921 12:57377580-57377602 CTTGACTCCTGTGAGTCAACTGG + Intronic
1097377963 12:58860847-58860869 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1097445636 12:59667997-59668019 CTTGACTTCTGTGTATCCACAGG - Intronic
1097474251 12:60034123-60034145 CTTGACTTCTGTGTGCCTGCAGG + Intergenic
1097558165 12:61166472-61166494 CTTGACTTCTGTGCACCCACGGG + Intergenic
1097757966 12:63427618-63427640 CTTGACTTCTGTGTACCCATAGG + Intergenic
1098202136 12:68067835-68067857 CTTCATTTCTGTGTGCTTTCAGG + Intergenic
1098493855 12:71112361-71112383 CTTGATTTCTGTGCACCTGCAGG + Intronic
1098509181 12:71291782-71291804 CTTGACTTCTGTGCACCCACAGG + Intronic
1098686966 12:73434197-73434219 CTTGACTTCTGTGTACCCAGAGG - Intergenic
1098778532 12:74654053-74654075 CTTGACTTCTGTGTACTCACAGG + Intergenic
1098830855 12:75360908-75360930 CTTGACTTCTGTGTACCCACAGG + Intronic
1098837713 12:75441974-75441996 CTTGACTTCTGTGTACCCACAGG - Intergenic
1098904231 12:76145411-76145433 CTTTATTTCTGTGTGGGAAGTGG - Intergenic
1099352570 12:81591709-81591731 CTTGACTTCTGTGCACCCACAGG - Intronic
1099390161 12:82069937-82069959 CTTGACTTCTGTGCACCCACAGG + Intergenic
1099707864 12:86180192-86180214 CTTGACTTCTGTGTACCCACAGG - Intronic
1100159670 12:91843630-91843652 CTTGTCTTCTGTGTACCCACAGG - Intergenic
1100678455 12:96893461-96893483 CTTGACTTCTGTGCACCCACAGG - Intergenic
1100971941 12:100079963-100079985 CTTGACTTCTGTGCACCAGCAGG - Intronic
1101516389 12:105439441-105439463 CTTGACTTCTGTGCACCCACAGG + Intergenic
1101526394 12:105535079-105535101 CTTGACTTCTGTGTACTCACAGG + Intergenic
1101558874 12:105836851-105836873 CTTGGTTTCTGTGTGACCTCGGG - Intergenic
1101663570 12:106788584-106788606 CTTGACTTCTGTGCACCCACAGG + Intronic
1101829240 12:108244214-108244236 ATTGATTGCTGTCTGCAAACTGG - Intronic
1102211726 12:111132143-111132165 CTTGACTTCTCTGTGCCTGCAGG + Intronic
1102248887 12:111372346-111372368 CTTGACTTCTGTGCACCCACAGG + Intergenic
1102740899 12:115206782-115206804 CCTTATTTCTGTCTGCCCACAGG + Intergenic
1102758757 12:115367018-115367040 CTTGAGTTCTGTGTACTCACAGG - Intergenic
1102794716 12:115678912-115678934 CTTGACTTCTGTGCACCCACAGG - Intergenic
1104861162 12:131924632-131924654 CTTGATTTCTGAGTCCCAAGAGG + Intergenic
1105235947 13:18553822-18553844 CTTGATTTCTGTGTACCTGGAGG - Intergenic
1105691577 13:22845179-22845201 CTTGAATTCTGTGTGCATACGGG + Intergenic
1106765262 13:32907137-32907159 CTGGATTTGTTTGAGCCAACTGG + Intergenic
1106864433 13:33948310-33948332 CTTGACTTCTGTGCACCCACAGG - Intronic
1107888189 13:44891886-44891908 CCTGATCTCTGTCTGCCCACTGG + Intergenic
1108184331 13:47873362-47873384 CTTGATTTCTGTGCACTCACAGG + Intergenic
1108419474 13:50233903-50233925 CTTGACTTCTGTGCACCCACAGG - Intronic
1108850865 13:54727824-54727846 CTTGACTTCTGTGTACCCACAGG - Intergenic
1108872623 13:55005427-55005449 CTTGAATTCTGTGCACCCACAGG + Intergenic
1108927400 13:55769927-55769949 CTTGAGTTCTGTGTACCTGCAGG - Intergenic
1108933970 13:55864470-55864492 CTTGACTTCTGTGTACCCACAGG - Intergenic
1108936786 13:55891500-55891522 CTTGACTTCTGTGCACCCACAGG + Intergenic
1109086107 13:57973208-57973230 CTTGACTTCCGTGTACCCACAGG + Intergenic
1109334859 13:60981233-60981255 CTTGACTTCTGTGTACCCACAGG + Intergenic
1109346945 13:61125890-61125912 CTTGAGTTCTGTGCACCCACAGG + Intergenic
1109416852 13:62051668-62051690 CTTGACTTCTGTGCACCCACAGG - Intergenic
1109616207 13:64837154-64837176 CTTGTCTTCTGTGTACCCACAGG - Intergenic
1109641962 13:65202858-65202880 CTTGACTTCTGTGCACCCACAGG - Intergenic
1109749579 13:66672335-66672357 TTTGATTTCTGTGCACCCACAGG - Intronic
1110008806 13:70305955-70305977 CTTGACTTTTGTGAGCCTACAGG - Intergenic
1110044408 13:70810582-70810604 CTTGACTTCTGTGCACCCACAGG - Intergenic
1110496507 13:76174227-76174249 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1110566238 13:76959956-76959978 CTTGACTTCTGTGCACCCACAGG + Intergenic
1111105734 13:83642934-83642956 CTTGATTTCTGTGCACCCAAAGG + Intergenic
1111143827 13:84155921-84155943 CTTGACTTCTGTGTACTCACAGG - Intergenic
1111154925 13:84309759-84309781 CTTGATTTCTGTGTACCCGCAGG - Intergenic
1111163151 13:84421370-84421392 CTTCACTTCTGTGTACCCACAGG - Intergenic
1111217492 13:85163346-85163368 CTTGCATTCTGTGTGCCTTCAGG + Intergenic
1111218817 13:85178739-85178761 CTTGACTTCTGTGCACCCACAGG + Intergenic
1111268450 13:85850273-85850295 CTTGACTTCTGTGTACTCACAGG + Intergenic
1111271485 13:85892640-85892662 CTTGACTTCTGTGCACCCACAGG - Intergenic
1111385462 13:87521465-87521487 CTTGACTTCTGTGTACCCGCAGG - Intergenic
1111472058 13:88695822-88695844 CTTGACTTCTGTGCACCCACAGG + Intergenic
1111621593 13:90731924-90731946 CTTGACTTCTGTGCACCAGCAGG - Intergenic
1111715740 13:91877041-91877063 CTTGACTTTTGTGTACCCACAGG - Intronic
1112259320 13:97863842-97863864 CTTGACTTCTGTGCACCTACAGG + Intergenic
1112450997 13:99509486-99509508 CTTGAACTCTGTGTGCCTGCAGG + Intronic
1112582709 13:100690357-100690379 CTTGACTTTTGTGTACCCACAGG - Intergenic
1112857798 13:103792382-103792404 CTTGACTTCTGTGCACCCACAGG + Intergenic
1112859138 13:103808631-103808653 CTTGTCTTCTGTGTACCAATAGG - Intergenic
1112887605 13:104193530-104193552 CTTGACTTCTGTGTACTCACAGG - Intergenic
1112929128 13:104713439-104713461 TTTGTGTTCTGTGTGCCTACAGG + Intergenic
1113133103 13:107060131-107060153 CTTAACTTCTGTGTACCCACAGG + Intergenic
1113497538 13:110743715-110743737 CTTGACTTTTGTGTACCCACAGG + Intergenic
1113645293 13:111990724-111990746 CTTGACTTCTGTGCACCTACAGG - Intergenic
1114147450 14:19993917-19993939 CTTGACTTCTGTGCACCCACAGG + Intergenic
1114778684 14:25514803-25514825 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1114917793 14:27289066-27289088 CTTGATTTCTGTGCCCCCACAGG + Intergenic
1114941967 14:27623819-27623841 CTTGATTTCTGTGCACTCACAGG + Intergenic
1114954867 14:27805229-27805251 CTTGACTTCTGTGTACCCTCAGG - Intergenic
1114987683 14:28250995-28251017 CTTGACTTCTGTGCACCCACAGG + Intergenic
1115009091 14:28522516-28522538 CTTGACTTCTGTGCACCCACAGG - Intergenic
1115115891 14:29880374-29880396 CTTGACTTCTGTGTACCAGCAGG - Intronic
1115199122 14:30834404-30834426 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1115249432 14:31330217-31330239 CTTGAATTCTGTGCACCAGCAGG + Intronic
1115655460 14:35439322-35439344 CTGGGTTTCTGTGTGCTATCAGG + Intergenic
1115878778 14:37891871-37891893 CTTGACTTCTGTGCACCCACAGG - Intronic
1115990024 14:39141664-39141686 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116079725 14:40156645-40156667 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116154488 14:41186000-41186022 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116164168 14:41311905-41311927 CTTGACTTCTGTGCACCCACAGG - Intergenic
1116383164 14:44297099-44297121 CTTGGATTCTGTGTGCCTGCAGG + Intergenic
1116533892 14:46007137-46007159 CTTGACTTCTGTGTACTCACAGG - Intergenic
1116564899 14:46432499-46432521 CTTGACTTCTGTGCACCCACAGG + Intergenic
1116714164 14:48407060-48407082 CTTGACTTCTGTGCACCCACAGG + Intergenic
1117186282 14:53243882-53243904 CTTGACTTCTGTGTACTCACAGG - Intergenic
1117427916 14:55620550-55620572 CTTGACTTCTGTGCACCCACAGG + Intronic
1117445152 14:55797165-55797187 CTTCCTTTCTGTGTGACAGCTGG - Intergenic
1117632728 14:57710272-57710294 CTTGACTTCTGTGCACGAACAGG - Intronic
1117749234 14:58903121-58903143 CTTGACTTCTGTGCACCCACAGG - Intergenic
1117854189 14:60010276-60010298 CTTGACTTCTGTGTACCCACAGG + Intronic
1117907506 14:60605722-60605744 CTTGACTTCTGTGCACCCACAGG - Intergenic
1117908230 14:60612034-60612056 CTTGACTTCTGTGCACCCACAGG + Intergenic
1118046512 14:61976532-61976554 CTTGACTTCTGTGCACCCACAGG + Intergenic
1118070887 14:62245730-62245752 CTTGATTTCTGTGCACCCAGAGG - Intergenic
1118239598 14:64043679-64043701 CTTGACTTCTGTGTACCCACAGG - Intronic
1118402862 14:65395475-65395497 CTTGATTTCTGTGTATCTGCAGG + Intergenic
1118685807 14:68289954-68289976 TTTAAGTTCTGTGTGCCCACTGG - Intronic
1119040389 14:71269386-71269408 CTTGACTTCTGTGCACCCACAGG - Intergenic
1119071829 14:71593655-71593677 CTTGGTTTCTGTGGCCCCACAGG + Intronic
1119200550 14:72748816-72748838 CTTGACTTCTGTGTACTCACAGG - Intronic
1119450147 14:74702346-74702368 CTTGACTTCTGTGCACCCACAGG + Intronic
1119934003 14:78574103-78574125 CTTGACTTCTGTGCACCCACAGG - Intronic
1120060686 14:79978768-79978790 CTTGATTTCTGTGCACCTGCAGG - Intergenic
1120152703 14:81055217-81055239 CTTGACTTCTGTGTACCCACAGG - Intronic
1120367012 14:83583561-83583583 CTTGACTTCTGTGTACCCACAGG - Intergenic
1120392815 14:83929806-83929828 CTTGATTTCTGTGCACCCACAGG - Intergenic
1120417948 14:84243614-84243636 CTTGACTTCTGTGAACCTACAGG + Intergenic
1120583224 14:86279819-86279841 CTTGACTTCTGTGCACCCACAGG - Intergenic
1120590956 14:86372764-86372786 CTTGACTTCTGTGCACCCACAGG - Intergenic
1120707660 14:87761268-87761290 CTTGATTTCTGTGCACCCACAGG - Intergenic
1120933801 14:89874133-89874155 CTTGACTTCTGTGTACCCACAGG + Intronic
1121063452 14:90938620-90938642 CTTGACTTCTGTGTACCCACAGG + Intronic
1121147008 14:91593066-91593088 CTTGACTTCTGTGCACCCACAGG - Intronic
1122756485 14:103984526-103984548 CTTGACTTCTGTGCACCCACAGG - Intronic
1122765492 14:104066630-104066652 CTTGACTTCTGTGCACCTACAGG + Intergenic
1123138245 14:106050454-106050476 CTTGACTTCTGTGTACTCACTGG - Intergenic
1123411791 15:20066924-20066946 CATAATGTCTGTGTGCCAACTGG - Intergenic
1123521135 15:21074043-21074065 CATAATGTCTGTGTGCCAACTGG - Intergenic
1123737564 15:23200183-23200205 CTTGACTTCTGTGCGCCTGCAGG + Intergenic
1123795606 15:23767148-23767170 CTTGACTTCTGTGCACCCACAGG - Intergenic
1124288777 15:28428845-28428867 CTTGACTTCTGTGCGCCTGCAGG + Intergenic
1124294448 15:28488468-28488490 CTTGACTTCTGTGCGCCTGCAGG - Intergenic
1124461621 15:29897315-29897337 CTTGACTTCTGTGCGCCTGCAGG - Intronic
1124695831 15:31863480-31863502 CTTGACTTCTGTGTACCCACAGG + Intronic
1125304223 15:38291609-38291631 CTTGACTTCTGTGCACCCACAGG + Intronic
1125761980 15:42103084-42103106 CTTCCCTTCTGTGTGCCACCCGG + Intergenic
1126825077 15:52540467-52540489 CTTGACTTCTGTGCACCCACAGG + Intergenic
1126942449 15:53781243-53781265 CTTGACTTCTGTGCACCCACAGG + Intergenic
1127576261 15:60295275-60295297 CTTGACTTCTGTGCACCCACAGG + Intergenic
1129628923 15:77235946-77235968 CTTGACTTCTGTGCACCCACAGG - Intronic
1130324167 15:82865810-82865832 CTTGACTTCTGTGTACCTGCAGG - Intronic
1130762151 15:86831974-86831996 CTTGACTTCTGTGTCCCTGCAGG + Intronic
1130778403 15:87009348-87009370 CTTGACTTCTGTGTACTCACAGG - Intronic
1130839789 15:87687486-87687508 CTGGATTCCTGGGTGCTAACTGG + Intergenic
1132026437 15:98407920-98407942 CTTATTTTCTGTCTGCCAAGGGG - Intergenic
1134476077 16:14575018-14575040 CTTGACTTCTGTGTGCCCACAGG - Intronic
1135530079 16:23245604-23245626 CTCTATTTCTGTGTTCCCACTGG - Intergenic
1135919040 16:26631819-26631841 CTTGACTTCTGTGCACCCACAGG + Intergenic
1137951924 16:52791928-52791950 CTTGATTTCTGTGCATCTACAGG - Intergenic
1139130972 16:64144463-64144485 CTTTATTTTTATATGCCAACTGG + Intergenic
1139197197 16:64933299-64933321 ATTGATTTATGTGAGCCATCTGG + Intergenic
1139241025 16:65392615-65392637 CTTGATTTCTGTAACACAACAGG + Intergenic
1139353260 16:66351156-66351178 CTGGCTTGCTGTGTGCCTACTGG - Intergenic
1139812772 16:69636577-69636599 CTTGACTTCTGTGCACCCACAGG + Intronic
1139982411 16:70870572-70870594 CTTGACTTCTGTGCACCCACAGG - Intronic
1140623371 16:76763332-76763354 CCTGCATTCTGTGTGCCTACAGG - Intergenic
1141214204 16:82009063-82009085 CTTGACTTCTGTGTACCCACAGG - Intronic
1141273054 16:82558286-82558308 CTTGACTTCTGTGCACCCACAGG - Intergenic
1143784675 17:9247488-9247510 CTTCATTTCTGTGGACCCACAGG - Intergenic
1144187293 17:12808475-12808497 CTTGACTTCTGTGCACCCACGGG + Intronic
1144500135 17:15779134-15779156 TTTGACTTCTGTGTACCCACAGG + Intergenic
1144508776 17:15857207-15857229 CTTGACTTCTGTGTACCCACAGG - Intergenic
1144538523 17:16115073-16115095 CTTGACTTCTATGTACCCACAGG + Intronic
1145172893 17:20674847-20674869 CTTGACTTCTGTGTACCCACAGG - Intergenic
1145782640 17:27573050-27573072 CTTTATTTCTGTAGGCAAACGGG - Intronic
1146205055 17:30897157-30897179 CTTTATTTGTGTGTGGCAACAGG + Intergenic
1146697367 17:34919958-34919980 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1147015217 17:37486786-37486808 TTTGATTTCAGGGTGCCATCGGG - Intergenic
1148246001 17:46031239-46031261 CTGAACTTCTGTTTGCCAACGGG + Exonic
1149051407 17:52309861-52309883 CTTGACTTCTGTGCACCCACAGG + Intergenic
1150687379 17:67331649-67331671 CTTGACTTCTGTGCACCCACAGG - Intergenic
1150830902 17:68518432-68518454 CTTGACTTCTGTGCACCCACAGG + Intronic
1151086629 17:71388042-71388064 CTTGACTTCTGTGCACCCACAGG + Intergenic
1151444147 17:74152338-74152360 CTTTATTTCTGTGTTCCTCCTGG + Intergenic
1153421917 18:4916645-4916667 CTTGACTTCTGTGTACCCACAGG + Intergenic
1153426878 18:4974925-4974947 CTTGACTTCTGTGCGCTCACAGG + Intergenic
1154313154 18:13282927-13282949 CTTGACTTCTGTGTACCCGCAGG + Intronic
1154513596 18:15136176-15136198 CTTGATTTCTGTGTACCTGGAGG + Intergenic
1154977576 18:21474533-21474555 GTTGACTTCTGTGTACCCACAGG + Intronic
1155516000 18:26624546-26624568 CTTGACTTCTGTGTACCCACAGG - Intronic
1155544764 18:26903700-26903722 CTTGATTTCTGTGCACCCACAGG + Intergenic
1155716681 18:28952614-28952636 CTTGAATTCTGTGCACCTACAGG + Intergenic
1155851696 18:30782608-30782630 CTTGACTTCTGTGCACCCACAGG - Intergenic
1156153059 18:34266397-34266419 CTTGATTTCTGTGCACCCACAGG - Intergenic
1156207904 18:34906102-34906124 CTTGACTTACGTGTGCCCACAGG + Intergenic
1156243598 18:35276617-35276639 CTTAACTTCTGTGTGTCCACAGG - Intronic
1156265909 18:35488397-35488419 CTTGACTTCTGTGCACCCACAGG + Intronic
1156344282 18:36241786-36241808 CTTGACTTTTGTGTACCCACAGG + Intronic
1156467565 18:37357385-37357407 CTTGACTTCTGTGTACTCACAGG - Intronic
1156736242 18:40263201-40263223 CTTGCATTCTGTGTACCTACAGG - Intergenic
1156769161 18:40698477-40698499 CTTGAATTCTGTGCACCCACAGG - Intergenic
1158056354 18:53285450-53285472 CTTGACTTCTGTGTACCTGCAGG - Intronic
1158166555 18:54547332-54547354 CTTGACTTCTGTGCACCTACAGG - Intergenic
1158786715 18:60721625-60721647 CTTGACTTCTGTGCACCCACAGG + Intergenic
1158822646 18:61178948-61178970 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1159131148 18:64281504-64281526 CTTGATTTCTGTGTACTGATAGG - Intergenic
1159180280 18:64893477-64893499 CTTGACTTCTGTGTACCCACAGG + Intergenic
1159215567 18:65386987-65387009 CTTGACTTCTGTGAACCCACAGG - Intergenic
1159282920 18:66310476-66310498 CTTGATTTCTGTTAACCCACAGG + Intergenic
1159481459 18:68995581-68995603 CTTGACTTCTGTGCACCTACAGG - Intronic
1159574401 18:70157368-70157390 CTTGGTTTCTGTGTGCTTTCAGG - Intronic
1159751053 18:72303006-72303028 ATTGACTTCTGTGTACCTACAGG + Intergenic
1160082031 18:75737010-75737032 CTTGACTTCTGTGTACCTAGAGG - Intergenic
1160599402 18:80001221-80001243 CTTGACTTCTGTGCACCCACAGG - Intronic
1163230089 19:15995812-15995834 CTTGACTTCTGTGCACCCACAGG - Intergenic
1163539700 19:17900517-17900539 CTTGACTTCTGTGCACCCACAGG - Intergenic
1164414081 19:28031645-28031667 CTTGACTTCTGTGCACCCACAGG + Intergenic
1164541464 19:29124511-29124533 CTTGACTTCTGTGTACCCACAGG + Intergenic
1164792598 19:31001108-31001130 CTTGATTTTTTTTTTCCAACTGG + Intergenic
1164850917 19:31483482-31483504 CTTGCATTCTGTGTGCCTGCAGG + Intergenic
1168702432 19:58449202-58449224 CTTGAGTTCTGTGCACCCACAGG - Intergenic
925001214 2:404178-404200 CTTGACTTCTGTGCACCCACAGG + Intergenic
925245596 2:2379762-2379784 CTTGACTTCTGTGCACCCACAGG - Intergenic
925291933 2:2753820-2753842 CTTGACTTCTGTGTACCCACAGG - Intergenic
925554418 2:5114297-5114319 CTTGCATTCTGTGTACCCACAGG - Intergenic
925781963 2:7389498-7389520 TTTGACTTCTGTGTACCCACAGG + Intergenic
925817034 2:7763706-7763728 CTTGACTTTTGTGTACCCACAGG + Intergenic
926431037 2:12785941-12785963 CTTGACTTCTGTGCACCCACAGG + Intergenic
926483965 2:13432443-13432465 GTTGAATTCTGTGTACCCACAGG + Intergenic
926519913 2:13897696-13897718 CTTGAGTTCTGTGCACCCACAGG - Intergenic
926563683 2:14445653-14445675 CTTGCATTCTGTGTGCCTGCAGG + Intergenic
926597694 2:14809494-14809516 CTTGACTTCTGTGCACCCACAGG - Intergenic
926734620 2:16063457-16063479 CTTGACTTCTGTGTACCCACAGG + Intergenic
926926488 2:17993285-17993307 CTTGACTTCTGTGCACCCACAGG - Intronic
926947434 2:18203529-18203551 CTTGACTTCTGTGCACCCACAGG - Intronic
927127040 2:20021426-20021448 CTTGATTTCTGTGCACCTGCAGG + Intergenic
927641086 2:24845983-24846005 CTTGACTTCTGTGTGCCCACAGG - Intronic
928266598 2:29817273-29817295 TTTGATTTCTCTGTGACAACTGG + Intronic
928267515 2:29824157-29824179 CTTGACTTCTGTGTACCTGCAGG - Intronic
928609918 2:32982766-32982788 CTTGACTTCTGTGCACCCACAGG - Intronic
929020338 2:37546705-37546727 CTTGACTTCTGTGTACCTGCAGG + Intergenic
929382506 2:41369094-41369116 CTTGATTTCTGTGCACCCAGAGG + Intergenic
929528825 2:42732301-42732323 CTTGACTTCTGTGCACCCACAGG + Intronic
930230128 2:48834986-48835008 CTTGACTTCTGTGCACCCACAGG - Intergenic
930438477 2:51377133-51377155 CTTGACTTCTTTGTACCTACAGG - Intergenic
930456730 2:51615207-51615229 CTTGAATTCTGTGCACCCACAGG + Intergenic
930512092 2:52358532-52358554 CCTGATGTCTGTGTACCCACAGG - Intergenic
930560107 2:52950085-52950107 CTTGATTTCTGTGCACTTACAGG + Intergenic
930585609 2:53263713-53263735 CTTGACTTCTGTGTACCTGCAGG + Intergenic
930942130 2:57025841-57025863 CTTGACTTCTGTGCACCCACAGG + Intergenic
930960343 2:57253170-57253192 CTTGACTTCTGTGTACCCACAGG - Intergenic
931041433 2:58305216-58305238 CTTGATTTCTGTGCACCTGCAGG - Intergenic
931079445 2:58752867-58752889 CTTGACTTCTGTGGACCCACAGG - Intergenic
931949839 2:67350144-67350166 CTTGACTTCTGTGCACCCACAGG + Intergenic
931967127 2:67546443-67546465 CTTGACTTCTGTGTACACACAGG + Intergenic
931978595 2:67670075-67670097 CCTGATTTCTGTGTCATAACTGG + Intergenic
931983752 2:67721890-67721912 CTTGACTTCTGTGTACCTGCAGG - Intergenic
932062083 2:68512769-68512791 CTTAATTTCTGTGGACCATCTGG + Intronic
933008252 2:77023087-77023109 CTTGACTTCTGTGTACCTGCAGG + Intronic
933120696 2:78533406-78533428 CTTGATTTTTGTGTGTCAGATGG - Intergenic
933181301 2:79230425-79230447 CTTGACTTCTGTGTACCCACAGG - Intronic
933344504 2:81066082-81066104 CTTGACTTCTGTGTACCCACAGG + Intergenic
933439805 2:82297839-82297861 CTTGCATTCTGTGTGCCTGCAGG + Intergenic
933947195 2:87296939-87296961 CTTGACTTCTGTGCACCCACAGG + Intergenic
934113014 2:88759703-88759725 CTTGATTTTTGTGCACCCACAGG - Intergenic
934482455 2:94664064-94664086 CTTGACTTCTGTGTACCCTCAGG + Intergenic
934610583 2:95732408-95732430 CTTGATTTCTGTGCACCTACAGG + Intergenic
935139877 2:100343691-100343713 CTTGACTTCTGTGCACCTACAGG - Intergenic
935323052 2:101907064-101907086 CTTGACTTCTGTGTACCTGCAGG + Intergenic
935385227 2:102492431-102492453 CTTGACTTCTGTGCACCCACAGG + Intronic
935481434 2:103594825-103594847 CTTGATTTCTGTGCACCCGCAGG - Intergenic
935497047 2:103794304-103794326 CTTGACTTCTGTGCACCCACAGG + Intergenic
935724055 2:106007704-106007726 CTTGATTTCTGTGAACCCACAGG - Intergenic
936332997 2:111564629-111564651 CTTGACTTCTGTGCACCCACAGG - Intergenic
936543923 2:113373990-113374012 CTTGATTTCTGTGCACCCACAGG + Intergenic
936549789 2:113427313-113427335 CTTGACTTCTGTGCACCCACAGG - Intergenic
936777719 2:115994351-115994373 CTTGCATTCTGTGCGCCTACAGG - Intergenic
936792312 2:116164569-116164591 CTTGAATTCTGTGTACCCACAGG - Intergenic
936890692 2:117366442-117366464 CTTCACTTCTGTGCACCAACAGG + Intergenic
936909428 2:117575115-117575137 CTTGACTTCTGTGTACCTGCAGG + Intergenic
937031533 2:118744801-118744823 CTTGACTTCTGTGCACCTACAGG + Intergenic
937427644 2:121813453-121813475 CTTGACTTCTGTGCACCCACAGG - Intergenic
937561001 2:123223797-123223819 CTTGACTTCTGTGCACCCACAGG + Intergenic
937616087 2:123923488-123923510 CTTGCATTCTGTGTACCCACAGG + Intergenic
937619746 2:123971886-123971908 CATGATTTCTATGAGTCAACTGG + Intergenic
937800605 2:126076932-126076954 CTTGACTTCTGTGCACCCACAGG - Intergenic
937806500 2:126151258-126151280 CTTGACTTCTGTGCACCCACAGG + Intergenic
938510428 2:131936628-131936650 CTTGACTTCTGTGCACCTACAGG + Intergenic
938513837 2:131980787-131980809 CTTGATTTCTGTGTACCTGGAGG + Intergenic
938686387 2:133742228-133742250 CTTGACTTCTGTGCACCCACAGG + Intergenic
938850018 2:135250705-135250727 CTTGACTTCTGTGCACCCACAGG - Intronic
938868862 2:135453085-135453107 CTTGATTTCTGTGCACCTGCAGG + Intronic
939016896 2:136913718-136913740 CTTGACTTCTGAGTACCCACAGG - Intronic
939092061 2:137791138-137791160 CTTGACTTCTGTGCACCCACAGG + Intergenic
939128436 2:138205118-138205140 CTTGACTTCTGTGCTCCCACAGG + Intergenic
939137629 2:138315654-138315676 GTTGATTTCTGTGTAGCCACAGG + Intergenic
940155962 2:150657585-150657607 CTGGATTGCTGTTTGCAAACTGG + Intergenic
940387017 2:153085591-153085613 CTTGACTTCTGTGTATCCACAGG - Intergenic
940484087 2:154275515-154275537 CTTGACTTCTGTGAACCCACAGG - Intronic
940505340 2:154546643-154546665 CTTAATTTCTGTGTACCCACAGG - Intergenic
940547168 2:155102455-155102477 CTTGACTTCTGTGCACCCACAGG + Intergenic
940621729 2:156121689-156121711 CTTGACTTCTGTGCACCCACAGG - Intergenic
940783629 2:157959251-157959273 CTTGACTTCTGTGCACCTACAGG + Intronic
941307778 2:163892324-163892346 CTTGACTTCTGTGCACCCACAGG + Intergenic
941346238 2:164372555-164372577 CTTGATTTCTGTTCACCTACAGG - Intergenic
941445213 2:165591726-165591748 CTTGACTTCTGGGTACCCACAGG - Intronic
941535982 2:166722891-166722913 CTTGACTTCTGTGTGCCTGCAGG + Intergenic
941560295 2:167035994-167036016 CTTGACTTCTGTGTACCCAAGGG - Intronic
941803602 2:169687946-169687968 CTTGACTTCTGTGCACCTACAGG + Intronic
942082420 2:172413196-172413218 CTTAAGTTCTGGTTGCCAACTGG + Intergenic
942367089 2:175239253-175239275 CTTGACTTCTGTGTACCCGCAGG + Intergenic
942380514 2:175386027-175386049 CTTGACTTCTGTGCACCCACAGG - Intergenic
942419970 2:175797420-175797442 CTTGACTTCTGTGCACCCACAGG - Intergenic
942517925 2:176773135-176773157 CTTGACTTCTGTGTACCTGCGGG - Intergenic
942644499 2:178095774-178095796 CTTGACTTCTGTGTACCTGCAGG + Intronic
942724758 2:178994315-178994337 TTTGACTTCTGTGTACCCACAGG + Intronic
943072206 2:183153972-183153994 CTTGACTTCTGTGCACCCACAGG + Intronic
943108096 2:183572101-183572123 CTTGATTTCTGTGCACTCACAGG - Intergenic
943437682 2:187886306-187886328 CTTGATTTCTGTGCACCCATAGG + Intergenic
943483960 2:188456500-188456522 CTTGACTTCTGTGCACCCACAGG - Intronic
943804908 2:192111923-192111945 CTTGACTTCTGTGCACCCACAGG - Intronic
944250199 2:197573908-197573930 CCTGACTTCTGTGTACCCACAGG - Intronic
944272217 2:197796415-197796437 CTTGACTTCTGTGGGCCCACAGG + Intergenic
944477920 2:200125904-200125926 CTTGATTTCTGTGCACCTGCAGG + Intergenic
944613603 2:201437045-201437067 CTTGAGTTGTCTGTGACAACTGG - Intronic
944921021 2:204413144-204413166 CTTAACTTCTGTGTACCCACAGG - Intergenic
945618694 2:212106889-212106911 CTTGACTTCTGTGCACCACCAGG - Intronic
946039685 2:216773055-216773077 CATGATTTCTGTGTGCTGGCTGG + Intergenic
946709579 2:222492365-222492387 CTTGACTTCTGTGTGCCCACAGG + Intronic
946844890 2:223850476-223850498 CTTGACTTCTGTGCACCCACAGG - Intergenic
947396686 2:229694161-229694183 CTTGACTTCTGTGCACCCACAGG - Intronic
948346544 2:237303608-237303630 CTTGACTTCTGTGCACCCACAGG - Intergenic
948530690 2:238601519-238601541 CTTGCTGTCTGTGGGCCGACAGG + Intergenic
1169014764 20:2282564-2282586 ACTGATTTGTGTTTGCCAACTGG - Intergenic
1169320851 20:4632138-4632160 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1169477666 20:5947385-5947407 CTTCCTTTCTCTGTGCCACCAGG + Intronic
1169593940 20:7176822-7176844 CTTGACTTCTGTGCACCCACAGG + Intergenic
1169643013 20:7776492-7776514 ATTGATTTCTGTGAACCCACAGG - Intergenic
1169766415 20:9152531-9152553 CTTGACTTCTGTGCACCCACAGG - Intronic
1169999250 20:11596541-11596563 CTTGACTTCTGTGCACCCACAGG + Intergenic
1170037515 20:12004711-12004733 CTTGACTTCTGTGGACCCACAGG - Intergenic
1170475012 20:16706099-16706121 CTTGACTTCTGTGCACCCACAGG - Intergenic
1170495307 20:16917988-16918010 CATGATTTCTGGGGGCTAACTGG - Intergenic
1170741822 20:19065154-19065176 CTTGACTTCTGTGCACCCACAGG - Intergenic
1170750346 20:19139580-19139602 CTTGTCTTCTGTGTACCCACAGG + Intergenic
1170875284 20:20244399-20244421 CTTGACTTCTGTGTACTCACAGG + Intronic
1171118713 20:22549592-22549614 CTTGATTTCTGTGCACCCACAGG + Intergenic
1171749920 20:29038771-29038793 CTTGACTTCTGTGCACCCACAGG + Intergenic
1172893186 20:38281558-38281580 CTTGACTTCTGTGTACCCACAGG + Intronic
1173711042 20:45155952-45155974 CTTGAGTTCTGTGCACCCACAGG - Intergenic
1174661955 20:52221198-52221220 CTTGACTTCTGTGCACCCACAGG + Intergenic
1175008489 20:55710823-55710845 CTTGACTTCTGTGTACCCACAGG - Intergenic
1175195378 20:57239733-57239755 CTTGACTTCTGTGCACCCACAGG + Intronic
1175602989 20:60289906-60289928 CTTGCACTCTGTGTGCCCACAGG + Intergenic
1176315305 21:5237145-5237167 CTTGACTTCTGTGCACCCACAGG - Intergenic
1176704410 21:10101248-10101270 CTTGATTTCTGTGCATCCACAGG + Intergenic
1176779946 21:13182108-13182130 CTTGATTTCTGTGTACCTGGAGG - Intergenic
1176783400 21:13226698-13226720 CTTGACTTCTGTGCACCTACAGG - Intergenic
1176925624 21:14745528-14745550 CTTGCTTTCTGTATACCCACAGG + Intergenic
1177118157 21:17110093-17110115 CTTGACTTCTGTGTACCCGCAGG + Intergenic
1177236126 21:18391878-18391900 CTTGACTTCTGTGTACCTGCGGG + Intronic
1177401740 21:20614043-20614065 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177477650 21:21644788-21644810 CTTGATTTCTGTGCACCCACAGG - Intergenic
1177485029 21:21746016-21746038 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177529029 21:22336900-22336922 CTTGACTTCTGTGTACCCAGAGG - Intergenic
1177532319 21:22376184-22376206 CTTTTTTTCTGTGTACCTACAGG + Intergenic
1177599227 21:23289130-23289152 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177854209 21:26383518-26383540 CTTGACTTCTGTGCACCCACAGG - Intergenic
1177857910 21:26420081-26420103 CTTGACTTCTGTGCACCTACAGG + Intergenic
1177918737 21:27124117-27124139 CTTGATTTCTGGGCACCCACAGG + Intergenic
1177977597 21:27871134-27871156 CTTGATTTCTGTGTACCTGGAGG - Intergenic
1177981044 21:27915465-27915487 CTTGACTTCTGTGCACCAACAGG - Intergenic
1178469026 21:32875207-32875229 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1178634227 21:34288322-34288344 CTTGACTTCTGTGCACCCACAGG + Intergenic
1179170577 21:38969929-38969951 CTTCATTTCTGTTTGCAGACAGG - Intergenic
1179269608 21:39840571-39840593 CTTGATTTCTGAGTGCCTCCAGG + Intergenic
1179316423 21:40247950-40247972 CTTGACTTCTGTGCACCCACAGG + Intronic
1180251387 21:46592437-46592459 CTTGACTTCTGTGCACCTACAGG - Intergenic
1180393090 22:12303100-12303122 CTTGACTTCTGTGCACCCACAGG - Intergenic
1180406660 22:12561668-12561690 CTTGACTTCTGTGCACCCACAGG + Intergenic
1181177343 22:21045233-21045255 GCTGTTTTCTGTGTGCCACCAGG - Intergenic
1182330173 22:29546047-29546069 CTTGACTTCTGTGCACCCACAGG + Intronic
1182357316 22:29728132-29728154 CTTGAGTTGTGTTTGCCACCTGG + Intronic
1182650643 22:31848429-31848451 CTTGACTTCTGTGTACCTGCAGG + Intronic
1183004495 22:34890009-34890031 CTTGACTTCTGTGCACCCACAGG - Intergenic
1184157625 22:42678720-42678742 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1184800537 22:46756098-46756120 CCTGCATTCTGTGTGCCCACAGG + Intergenic
1184943884 22:47787441-47787463 CTTGACTTCTGTGTACCTGCAGG - Intergenic
949156253 3:830425-830447 CCTGACTTCTGTGTACCCACAGG + Intergenic
949464411 3:4329414-4329436 CTTGACTTCTGTGTACCCACAGG + Intronic
949673307 3:6424642-6424664 CTTGACTACTGTGTACCCACAGG + Intergenic
949692980 3:6662158-6662180 CTTGACTTCTGTGTACCCTCAGG + Intergenic
950468498 3:13170253-13170275 CTTGACTTCTGTGTACCCTCAGG - Intergenic
950573707 3:13817961-13817983 CTTGAGTTCTGTTTGCCAAGTGG - Exonic
950913207 3:16616423-16616445 CTCGACTTCTGTGTACCCACAGG - Intronic
951058230 3:18173071-18173093 CTTGACTTCTGTGTACCCGCAGG + Intronic
951317564 3:21205300-21205322 CTTGACTTCTGTGCACCCACAGG - Intergenic
951430151 3:22597271-22597293 CTTGCCTTCTGTGTACCCACAGG - Intergenic
951580883 3:24161106-24161128 TTTCATTTCTGGGTGCCAAGAGG + Intronic
951756452 3:26096460-26096482 CTTGACTTCTGTGCACCTACAGG + Intergenic
952198499 3:31101230-31101252 CTTGACTTCTGTGTACCCACAGG + Intergenic
952480230 3:33753793-33753815 CTTGACTTCTGTGTACCTGCAGG + Intergenic
952715084 3:36472125-36472147 CTTGACTTCTGTGCACCCACAGG + Intronic
952945740 3:38477090-38477112 CTTAATTTACGTGTGCCAGCTGG - Intronic
953933038 3:47016000-47016022 CTTGATTTTTCTGAGCCCACTGG - Intergenic
954605493 3:51906135-51906157 CTTGACTTCTGTGTACTCACAGG - Intergenic
955465262 3:59230408-59230430 CTTGACTTCTGTGTACCTGCAGG + Intergenic
956630318 3:71310804-71310826 CATGAGTTGTGTCTGCCAACTGG - Intronic
956910034 3:73807643-73807665 CTTGACTTCTGTGCACCCACAGG - Intergenic
957457646 3:80472832-80472854 CTTGACTTCTGTGCACCCACAGG - Intergenic
957470615 3:80653710-80653732 CTTGACTTCTGTGCACCCACAGG - Intergenic
957474420 3:80705293-80705315 CTTGACTTCTGTGTACCTGCAGG + Intergenic
957630526 3:82711251-82711273 CTTGACTTCTGTGCACCCACAGG + Intergenic
957873107 3:86112693-86112715 CTTGACTTCTGTGCACCCACAGG - Intergenic
957896328 3:86424950-86424972 CTTGACTTCTGTGCACCCACAGG + Intergenic
958537715 3:95425411-95425433 CTTGACTTCTGTGCACCCACAGG + Intergenic
958577713 3:95974010-95974032 CTTGACTTCTGTATACCTACAGG - Intergenic
958588162 3:96118079-96118101 CTTGACTTCTGTGCACCCACAGG - Intergenic
958590433 3:96151912-96151934 CTTAATAGCTGTGTGACAACTGG + Intergenic
958836232 3:99148279-99148301 CTTGACTTCTGTGCACCAGCAGG - Intergenic
958841426 3:99209740-99209762 CTTGCTTTCTGTGTGCCTGCAGG + Intergenic
958860246 3:99437150-99437172 CTTGACTTCTGTGCACCCACAGG - Intergenic
959004857 3:101008620-101008642 CTTGATTTCTATGTACTCACAGG + Intergenic
959730016 3:109590641-109590663 ATTGACTTCTGTGTACCCACGGG + Intergenic
959742566 3:109737491-109737513 CTTGACTTCTGTGTACCCACAGG + Intergenic
959814766 3:110662487-110662509 CTTGTTTTCTGTGCACCTACAGG - Intergenic
959838610 3:110949222-110949244 CTTGACTTCTGTGCACCCACAGG + Intergenic
959894132 3:111587740-111587762 CTTGACTTCTGTGCACCTACAGG + Intronic
960473205 3:118093292-118093314 CTTGACTTCTGTGCACCCACAGG - Intergenic
960564414 3:119118328-119118350 CTTGACTTCTGTGCACTAACGGG + Intronic
961669702 3:128519946-128519968 ATTGATTTCTCTGTGGCACCAGG - Intergenic
961789365 3:129364810-129364832 CTTGACTTCTGTGCACCCACAGG + Intergenic
961839539 3:129697248-129697270 CTTGACTTTTGTGTACCTACAGG + Intronic
962057339 3:131886306-131886328 CTTGACTTCTGTGTACCTGCAGG - Intronic
962231164 3:133666711-133666733 CTTTATTTTTGTTTGCAAACAGG - Intergenic
962461009 3:135612703-135612725 CTTGACTTCTGTGCACCCACAGG - Intergenic
962576918 3:136763386-136763408 CTTGACTTCTGTGCACCCACAGG - Intergenic
963394568 3:144715414-144715436 CTTGACTTCTGTGCACCCACCGG + Intergenic
963422089 3:145073374-145073396 CTTGACTTCTGTGCACCCACAGG + Intergenic
963515791 3:146306516-146306538 CTTGACTTCTGTGTACCTGCAGG + Intergenic
963516586 3:146316733-146316755 CTTGACTTCTGTGTGCCTGCAGG + Intergenic
963538941 3:146562417-146562439 CTTGACTTCTGTGTACCTGCAGG + Intergenic
964036308 3:152202451-152202473 CTACATTTCTGTGTTCTAACAGG + Intergenic
964090862 3:152874131-152874153 CTTGACTTCTGTGCACCCACAGG + Intergenic
964098605 3:152962708-152962730 CTTGACTTCTGTGCACCCACAGG + Intergenic
964605524 3:158556290-158556312 CTTGACTTCTGTGCACCCACAGG - Intergenic
964654552 3:159052086-159052108 CTTGACTTCTGTGCACCCACAGG - Intronic
964827298 3:160842776-160842798 TTTGATGTCTAGGTGCCAACTGG + Intronic
964836340 3:160942072-160942094 CTTGATTCATGGGTGCCATCTGG + Intronic
964912647 3:161801151-161801173 CTTGACTTCTGTGCACCCACAGG + Intergenic
965045495 3:163572381-163572403 CTTGACTTCTGTGTACCCACAGG - Intergenic
965386890 3:168056251-168056273 CTTGACTTCTGTGCACCCACAGG - Intronic
965662120 3:171052878-171052900 GTTGACTTCTGTGTGCCCACAGG - Intergenic
965795322 3:172433108-172433130 CTTGACTTCTGTGCACCCACAGG + Intergenic
966059236 3:175734605-175734627 CTTGGCTTCTGTGTACCCACAGG + Intronic
966164843 3:177006106-177006128 CCTGCTGTCTGTGTGCCTACAGG - Intergenic
966365436 3:179181463-179181485 CTTGGTTTCTTTGTTACAACTGG - Intronic
966741981 3:183242560-183242582 CTTGACTTCTGTGAACCCACAGG - Intronic
966747449 3:183290962-183290984 CTTCCATTCTGTGAGCCAACTGG + Intronic
967406198 3:189118740-189118762 CTTGACTTCTGTGTACCCACAGG - Intronic
967501588 3:190204022-190204044 CTTGATTTCTGAGCACCCACGGG - Intergenic
967519860 3:190416740-190416762 CTTGAATTCTGTGCACCCACAGG + Intergenic
967566564 3:190979992-190980014 CTTGTCTTCTGTGTACCCACAGG - Intergenic
967634387 3:191784294-191784316 CTTGATTTCTGTGCACCCACAGG + Intergenic
967703514 3:192622110-192622132 CATGGCTTCTCTGTGCCAACTGG + Intronic
967810401 3:193755080-193755102 CTTGACTTCTGTGCACCCACAGG - Intergenic
967908309 3:194520122-194520144 CTTGACTTCTGTGCACCCACAGG - Intergenic
968295129 3:197570655-197570677 CTTGACTTCTGTGCACCCACAGG - Intronic
968590455 4:1456418-1456440 CTTGACTTCTGTGTACCCACAGG + Intergenic
970100370 4:12514745-12514767 CTTGTCTTCTGTGTACCTACAGG - Intergenic
970339153 4:15086276-15086298 CTTGACTTCTGTGTACCCACAGG + Intergenic
970624409 4:17861288-17861310 CTTGACTTCTGTGCACCCACAGG + Intronic
970655928 4:18229827-18229849 CTTGACTTCTGTTTACCCACAGG + Intergenic
970706922 4:18815832-18815854 CTTGCATTCTGTGTGCCTATGGG - Intergenic
970818944 4:20190725-20190747 CTTGACTTCTGTGTACCCACAGG - Intergenic
971119640 4:23689474-23689496 CTTGACTTCTGTGCACCAGCAGG - Intergenic
971649712 4:29256681-29256703 CTTGACTTCTGTGTACCCACAGG - Intergenic
971896685 4:32605575-32605597 CTTGCTTTCTGTGTACCCACAGG + Intergenic
972002677 4:34058583-34058605 CTTGATTGCTGTGTGCCCACAGG + Intergenic
972063436 4:34910113-34910135 CTTGACTTCTGTGCACCTACAGG - Intergenic
972180981 4:36465134-36465156 CTTGTTTTCTCTGTGACAACAGG - Intergenic
972225307 4:37005229-37005251 CTTGATTTCTGGGCACCCACAGG - Intergenic
972444925 4:39135004-39135026 TGTGATTTCTGTCTCCCAACTGG - Intergenic
972484766 4:39530715-39530737 CTTGACTACTGTGTACCTACAGG + Intergenic
972756952 4:42057389-42057411 CTTGACTTCTGTGCACCCACAGG + Intronic
972809183 4:42563778-42563800 CTTGATTTCTGTGTACCCACAGG - Intronic
973032384 4:45360660-45360682 CTTGACTTCTGTGCACCCACAGG - Intergenic
973063876 4:45763539-45763561 CTTGACTTCTGTGTACCTGCAGG + Intergenic
973229949 4:47829474-47829496 CCTGAGTTCTGTGAGCCATCAGG + Intronic
974071438 4:57127691-57127713 CTTGACTTCTGTGCACCCACAGG - Intergenic
974125671 4:57692986-57693008 CTTGATGTCTGTGCACCCACAGG - Intergenic
974177649 4:58344919-58344941 CTTGACTTCTGTGTACCTGCAGG - Intergenic
974319921 4:60334043-60334065 CTTGACTTCTGTGTACCAGCAGG - Intergenic
974494962 4:62614918-62614940 CTTGACTTCTGTGCACCCACAGG + Intergenic
974620359 4:64346474-64346496 CTTGACTTCTGTGTACCTGCAGG + Intronic
974842123 4:67310487-67310509 CTTGACTTCTGTGCACCTACAGG - Intergenic
974897603 4:67958006-67958028 CTTGACTTCTGTGTACCTGCAGG - Intronic
974966061 4:68761802-68761824 ATTGATTTCTGTGTACCCACAGG + Intergenic
975307341 4:72865349-72865371 CTTGACTTCTGTGCACCCACAGG - Intergenic
975312011 4:72913615-72913637 CTTGACTTCTGTGCACCCACAGG - Intergenic
975878261 4:78869180-78869202 CTTGACTTCTGTGCACCCACAGG + Intronic
976003611 4:80401522-80401544 CTTGACTTCTGTATACCCACAGG - Intronic
976051115 4:81012412-81012434 CTTGACTTCTGTGCCCCCACAGG - Intergenic
976051567 4:81016614-81016636 CTTGACTTCTGTGCCCCCACAGG + Intergenic
976277165 4:83289622-83289644 CTTGACTTCTGTGCGCCCTCAGG - Intergenic
977014669 4:91677950-91677972 CTTGACTTCTGTGCACCCACAGG - Intergenic
977015985 4:91693707-91693729 CTTGATTTCTGTGCACCTGCAGG + Intergenic
977393926 4:96448659-96448681 CTTGACTTTTGTGTACCCACAGG - Intergenic
977435449 4:96989316-96989338 CTTGACTTCTGTGTACTCACAGG - Intergenic
977702513 4:100036191-100036213 CTTGACTTCTGTGCACCCACAGG + Intergenic
978846745 4:113282175-113282197 CTTGAATTGTGTGTGCTATCTGG - Intronic
978904052 4:113985471-113985493 CTTGACTTCTGTGTACCCACAGG - Intergenic
978939070 4:114415518-114415540 CTTGACTTCTGTGCACCCACAGG - Intergenic
978991245 4:115084710-115084732 CTTGATTTCTGTGTGCCAACAGG - Intronic
979038381 4:115754541-115754563 CTTGATTTCTGTGAACCTGCAGG - Intergenic
979125618 4:116968807-116968829 CTTGACTTCTGTGCACCCACAGG + Intergenic
979137510 4:117128009-117128031 CTTGACTTCTGTGCACCCACAGG - Intergenic
979327870 4:119400166-119400188 CTTGACTTCTGTGTACTCACAGG + Intergenic
979426413 4:120572591-120572613 CTTGACTTCTGTGCACCCACAGG + Intergenic
979867653 4:125776509-125776531 CTTGACTTCTATGTACCCACAGG - Intergenic
979974908 4:127184678-127184700 CTTGACTTCTCTGTGCCCACAGG - Intergenic
979984381 4:127295949-127295971 CTTGACTTCTGTGCACCCACAGG + Intergenic
980006850 4:127552396-127552418 CTTGATTTCTGTCTACCCACAGG - Intergenic
980201302 4:129658866-129658888 CTTGACTTCTGTGCACCCACAGG + Intergenic
980256031 4:130382093-130382115 CTTGACTTCTGTGTACCTGCAGG - Intergenic
980299142 4:130965295-130965317 CTTGACTTTTGTGTACCCACAGG - Intergenic
980324473 4:131324051-131324073 CTTGACTTCTGTGTACCCACAGG - Intergenic
980376618 4:131957579-131957601 CTTGATTTCTGTGCACCCACAGG + Intergenic
980408981 4:132390121-132390143 CTTGACTTCTGTGTACCCGCAGG - Intergenic
980422773 4:132585410-132585432 CTTGCCTTCTGTGTACCCACAGG - Intergenic
980494966 4:133578320-133578342 CTTGAATTCTGTGCACCCACAGG - Intergenic
980596530 4:134962344-134962366 CTTGACTTCTGTGTATCCACAGG - Intergenic
980850416 4:138374307-138374329 CTTGACTCCTGTGTCCCCACAGG + Intergenic
981121001 4:141051047-141051069 CTTGACTTCTGTGCACCCACAGG + Intronic
981200392 4:141972973-141972995 CTTGACTTCTGTGCACCATCAGG + Intergenic
981242387 4:142493119-142493141 CTTGACTTCTGTGCACCCACAGG - Intronic
981281680 4:142966248-142966270 CTTGACTTCTGTGAACCCACAGG + Intergenic
981359624 4:143831583-143831605 CTTGACTTCTGTGCACCCACAGG - Intergenic
981370384 4:143952652-143952674 CTTGACTTCTGTGCACCCACAGG - Intergenic
981380142 4:144062576-144062598 CTTGACTTCTGTGCACCCACAGG - Intergenic
982076004 4:151737840-151737862 CTTGACTTCTGTGCACCCACAGG - Intronic
982478400 4:155879486-155879508 CATGATTTCTGTGTACCCACCGG + Intronic
982554273 4:156840392-156840414 CTTGTTTTCTGTGCACCCACAGG - Intronic
982618901 4:157678523-157678545 CTTGACTTCTGTGTACCCGCAGG + Intergenic
982854370 4:160362495-160362517 CTTGATTTCTGTGCACCAACAGG + Intergenic
983048161 4:163011365-163011387 CTTGACTTCTGTGCACCCACAGG + Intergenic
983245622 4:165283887-165283909 CTTGACTTCTGTGTACTCACAGG + Intronic
983322703 4:166213786-166213808 CTTGACTTCTGTGCACCAGCAGG + Intergenic
983419233 4:167496456-167496478 CTTGACTTCTGTGCACCAGCAGG + Intergenic
983419624 4:167500819-167500841 CTTGATTTCTGTGCACTCACAGG + Intergenic
983460711 4:168022941-168022963 CTTGACTTCTGTGCACTAACAGG + Intergenic
983742194 4:171149694-171149716 TTTGAATTCTGTGTACCACCGGG - Intergenic
983863332 4:172734916-172734938 CTTGACTTCTGTGTACCTGCAGG - Intronic
984232099 4:177112073-177112095 CTTGATTTCTGTGCACTAGCGGG + Intergenic
984301606 4:177926908-177926930 GTTGATTTTTGTGTGACAAGAGG + Intronic
984512274 4:180693417-180693439 CTTGACTTCTGTGCACCCACAGG + Intergenic
984620027 4:181942135-181942157 CCTAATCTCTGCGTGCCAACTGG + Intergenic
985431827 4:189888421-189888443 CTTGACTTCTGTGCACCCACAGG + Intergenic
985852946 5:2402081-2402103 CTTGATTTCTGTGCACCCACAGG - Intergenic
986113934 5:4750641-4750663 CTTGACTTCTGTGCACCCACAGG + Intergenic
986129084 5:4910449-4910471 CTTGACTTCTGTGCGTCCACAGG + Intergenic
986246545 5:6012234-6012256 CTTGACTTCTGTGTGCCCACAGG + Intergenic
986291743 5:6405440-6405462 CTTTATTTGTGTGTGCCAAGTGG - Intergenic
986455302 5:7912355-7912377 CTTGACTTCTGTGCACCCACAGG + Intergenic
986533391 5:8761815-8761837 CTTTACTTCTGTGTACCCACAGG - Intergenic
987102588 5:14605171-14605193 CTTGACTTCTGTGTACCCACAGG + Intronic
987216579 5:15743836-15743858 CTTGACTTCTGTGGACCCACAGG + Intronic
987662448 5:20894536-20894558 CTTGATTTCTGTGAACCTGCAGG - Intergenic
987665401 5:20932309-20932331 CTTTAATTTTATGTGCCAACTGG + Intergenic
987744088 5:21947999-21948021 CTTGACTTCTGTGTACCCTCAGG - Intronic
987799505 5:22675340-22675362 CTTGACTTCTGTGCACCCACAGG - Intronic
987826300 5:23034715-23034737 CTTGACTTCTGTGCACCCACGGG + Intergenic
987873285 5:23647672-23647694 CTTGACTTCTGTGCCCCAACAGG - Intergenic
987894343 5:23925621-23925643 CTTGACTTCTGTGCACCCACAGG + Intergenic
988113694 5:26855582-26855604 CTTGCATTCTGTGTGCCTGCAGG + Intergenic
988204380 5:28115404-28115426 CTTGACTTCTGTGCACCAGCAGG + Intergenic
988378999 5:30477159-30477181 CTTGACTTCTGTGTACCCCCAGG + Intergenic
988379422 5:30481109-30481131 CTTGACTTCTGTGCACCCACAGG + Intergenic
988761134 5:34310781-34310803 CTTGATTTCTGTGAACCTGCAGG + Intergenic
988768093 5:34403529-34403551 CTTGACTTCTGTGTACCTGCAGG + Intergenic
989144470 5:38235095-38235117 CTTGATTTCTGTGCACCAGCGGG - Intergenic
989218308 5:38927441-38927463 CTTGACTTCTGTGCACCCACAGG + Intronic
989224555 5:39011258-39011280 CTTGACTTCTGTGCACCCACAGG - Intronic
991039183 5:62158735-62158757 CTTGACTTCTGTGTACCCACAGG - Intergenic
991183838 5:63785294-63785316 CTTGACTTCTGTGTACCTGCAGG - Intergenic
991340320 5:65601761-65601783 CTTGACTTCTGTGCACCCACAGG + Intronic
991409379 5:66331505-66331527 GTTGACTTCTGTGTACCCACAGG - Intergenic
991535919 5:67669296-67669318 CTTGACTTCTGTGCACCCACAGG - Intergenic
991764293 5:69958136-69958158 CTTGACTTCTGTGTACCCTCAGG - Intergenic
991783034 5:70160011-70160033 CTTGACTTCTGTGTACCCTCAGG + Intergenic
991843525 5:70833208-70833230 CTTGACTTCTGTGTACCCTCAGG - Intergenic
991875476 5:71160338-71160360 CTTGACTTCTGTGTACCCTCAGG + Intergenic
993098267 5:83505868-83505890 CTTGACTTCTGTGCACCCACAGG + Intronic
993257888 5:85616829-85616851 CTAGACTTCTGTGTACCCACCGG + Intergenic
993263741 5:85694668-85694690 CTTGTCTTCTGTGTACCCACAGG + Intergenic
993344700 5:86768808-86768830 CTTGCATTCTGTGAGCCCACAGG + Intergenic
993703884 5:91148487-91148509 CTTGTCTTCTGTGTACCCACAGG - Intronic
993743314 5:91565381-91565403 CTTGACTTCTGTGCACCCACAGG + Intergenic
993890137 5:93463306-93463328 CTTTACTTCTGTGTACCCACAGG - Intergenic
994018977 5:95002111-95002133 CTTGACTTCTGTGCACCCACAGG - Intronic
994253901 5:97570234-97570256 CTTGACTTCTGTGTACCTGCAGG + Intergenic
994338773 5:98600928-98600950 CTTGACTTCTGTGTACCCACAGG - Intergenic
994440803 5:99800605-99800627 CTTGACTTCTGTGCACCCACAGG + Intergenic
994570146 5:101505302-101505324 CTTGCATTCTCTGTGCCTACAGG - Intergenic
994689530 5:102999671-102999693 CTTGACTTCTGTGCACCCACAGG + Intronic
994808249 5:104479362-104479384 CTTGACTTCTGTGCACCCACAGG - Intergenic
994823320 5:104680715-104680737 CTTGACTTCTGTGCACCCACAGG - Intergenic
994833016 5:104810179-104810201 CTTGACTTCTGTGCACCCACAGG + Intergenic
994840926 5:104924035-104924057 CTTGCATTCTGTGTGCCTGCAGG - Intergenic
994878133 5:105451225-105451247 CTTGACTTCTGTGTACCTGCAGG - Intergenic
995120666 5:108532541-108532563 CTTGACTTCTGTGCACCCACAGG + Intergenic
995220370 5:109641331-109641353 CTTGGCTTCTGTGTACCAGCAGG - Intergenic
995294865 5:110507960-110507982 CTTGATATCTGTATGCTAATAGG + Intronic
995370137 5:111409271-111409293 CTTGACTTCTGTGCACCCACAGG + Intronic
995390983 5:111640010-111640032 CTTGACTTCTGTGTACCCACAGG - Intergenic
995761371 5:115565608-115565630 CTTGCATTCTGTGTACCCACAGG - Intergenic
995997867 5:118322768-118322790 CTTGACTTCTGTGCACCCACAGG + Intergenic
996453704 5:123656289-123656311 CTTGTCTTCTGTGTACCTACAGG + Intergenic
996617394 5:125457972-125457994 CTTGACTTCTGTGTACCCACAGG - Intergenic
996911380 5:128660649-128660671 CTTGACTTCTGTGCACCCACAGG - Intronic
997056666 5:130452152-130452174 CTTGACTTCTGTGTACCCACAGG + Intergenic
997057349 5:130460188-130460210 CTTGACTTCTGTGTACCCACAGG - Intergenic
997181420 5:131832715-131832737 CTTGACTTCTGTGCACCCACAGG + Intronic
997651343 5:135523718-135523740 CTTGACTTCTGTGCACCCACAGG + Intergenic
997716675 5:136047864-136047886 CTTGACTTCTGTGTCCACACTGG - Intronic
998278625 5:140783162-140783184 CTTGCATTCTGTGCGCCTACAGG - Intergenic
998576664 5:143324317-143324339 CTTGACTTCTGTGTACCCACAGG + Intronic
998722983 5:144975506-144975528 CTTGACTGCTGTGTACCCACAGG - Intergenic
998794424 5:145803123-145803145 CCTTATTTCTGTGTGCTTACAGG - Intronic
998926070 5:147127775-147127797 CTTGACTTCTGTGCACCCACTGG + Intergenic
999520743 5:152348417-152348439 CCTGATCTCTGTCTACCAACTGG + Intergenic
999668134 5:153934560-153934582 CTTGACTTCTGTGTACCCACAGG + Intergenic
999804894 5:155072154-155072176 CTTGACTTCTGTGCACCCACAGG + Intergenic
1000226528 5:159266847-159266869 CTTGACTTCTGTGTACCCACAGG - Intronic
1000564901 5:162834977-162834999 CCTGACTTCTGTGTACCCACAGG + Intergenic
1000676333 5:164126924-164126946 CTTGATTTCTGTGCACCCACAGG + Intergenic
1000751106 5:165097617-165097639 CTTGACTTCTGTGCCCCCACAGG + Intergenic
1000784636 5:165528562-165528584 CTTGACTTCTGTGCACCCACAGG - Intergenic
1001684925 5:173586160-173586182 CTTGACTTCTGTGCACCTACAGG + Intergenic
1002069074 5:176668146-176668168 CTTGATTTCTGTTCTCCAAAGGG + Intergenic
1003230034 6:4243558-4243580 CTTGACTTCTGTGCACCCACAGG + Intergenic
1003360557 6:5421148-5421170 CTTGACTTCTGTGTACTCACAGG + Intronic
1004805723 6:19201810-19201832 CTTGATTTCTGTGCACCCACAGG + Intergenic
1005917254 6:30364044-30364066 CTAGATTTCTATGTATCAACTGG + Intergenic
1005982990 6:30851731-30851753 CTTGACTTCTGTGCACCCACAGG - Intergenic
1006315989 6:33292070-33292092 CATGACTTCTGTAAGCCAACGGG + Exonic
1006697137 6:35940747-35940769 CTTGACTTCTGTGCACCCACAGG - Intergenic
1007553694 6:42748492-42748514 CTTCATTTCTGTCTACCAACAGG + Intronic
1007889298 6:45271499-45271521 CTTGACTTCTGTGCACCCACAGG - Intronic
1007968960 6:46031281-46031303 ATTATTTGCTGTGTGCCAACGGG + Intronic
1008363607 6:50650114-50650136 CTTGACTTCTGTGTACCTGCTGG - Intergenic
1008650096 6:53552897-53552919 CTTGATTTCTGTGCACCTATAGG - Intronic
1008756134 6:54797283-54797305 CTTGACTTCTATGTACCCACAGG - Intergenic
1009309641 6:62134334-62134356 CTTGACTTCTGTGCACCTACAGG - Intronic
1009383612 6:63063116-63063138 CTTGACTTCTGTGCACCAAAAGG - Intergenic
1009550764 6:65088981-65089003 CTTGACTTCTGTGCACCCACAGG - Intronic
1009693743 6:67069273-67069295 CTTGACTTCTGTGCACCCACAGG - Intergenic
1009723474 6:67506369-67506391 CTTGACTTCTGTGCACCCACAGG + Intergenic
1009732172 6:67622380-67622402 CTTGACTTCTGTGCACCCACAGG - Intergenic
1009804945 6:68590734-68590756 CTTGACTTCTGTGTACACACAGG + Intergenic
1009945919 6:70341671-70341693 CTTGACTTCCGTGTGCCCACAGG + Intergenic
1010055127 6:71556212-71556234 CTTGACTTCTGTGTGCCCACAGG - Intergenic
1010263752 6:73845045-73845067 CTTGACTTCTGTGTACCCACAGG - Intergenic
1010539140 6:77069674-77069696 CTTGAGTTCTGTGCACCCACAGG + Intergenic
1010551029 6:77222651-77222673 CTTGACTTCTGTGCACCCACAGG - Intergenic
1010605950 6:77889921-77889943 CTTGACTTCTGTGTACCCATAGG - Intronic
1011031730 6:82931162-82931184 CTTGACTTCTGTGTACCCACAGG - Intronic
1011041153 6:83031910-83031932 CTTGACTTCTGTGCACCCACAGG - Intronic
1011211216 6:84958567-84958589 CTTGACTTCTGTGCACCCACAGG - Intergenic
1011264078 6:85497389-85497411 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1011343782 6:86346776-86346798 CTTAACTTCTGTGCACCAACAGG + Intergenic
1011382724 6:86760045-86760067 CTTGACTTCTGTGTACCCACAGG - Intergenic
1011544501 6:88468889-88468911 CTTGAATTCTGTATGCCTGCAGG - Intergenic
1011580302 6:88855759-88855781 CCTGTTGTCTGTGTGCCAGCTGG - Intronic
1011792716 6:90915595-90915617 CTTGACTTCTGTGCACCCACAGG - Intergenic
1011877077 6:91974803-91974825 CTTGATTTCTGTGTACCTGTAGG + Intergenic
1011942296 6:92857470-92857492 CTTGACTTCTGTGCACCCACAGG + Intergenic
1012179881 6:96139669-96139691 CTTGACTTCTGTGCACCCACAGG + Intronic
1012193397 6:96308883-96308905 CTTAATTTCTATGGGACAACTGG + Intergenic
1012202534 6:96424208-96424230 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1012751394 6:103168102-103168124 CCTGTCTTCTGTGTGCCCACAGG - Intergenic
1013213675 6:108008366-108008388 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1013503041 6:110771313-110771335 CTTGACTTCTGTGCACCCACAGG + Intronic
1013688085 6:112609283-112609305 CTTGACTTCTGTGCACCAGCAGG - Intergenic
1013863138 6:114660529-114660551 CTTGACTTCTGTGTACCTACAGG - Intergenic
1013935366 6:115587414-115587436 CTTGATTTCTGTGCACCTTCAGG - Intergenic
1014133981 6:117866583-117866605 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1014406995 6:121064689-121064711 CTTGATTTCTGTGCACCCACAGG - Intergenic
1014469990 6:121801836-121801858 CTTGACTTCTGTGTACCCACAGG - Intergenic
1014493450 6:122090639-122090661 TTAGATTTCTGTGTACCAAATGG + Intergenic
1014563027 6:122913911-122913933 CTTGACTTCTGTGTACCCACAGG - Intergenic
1014649517 6:124018088-124018110 CTTGATTTCTGTGCACTCACAGG + Intronic
1014661771 6:124181100-124181122 CTTGACTTCTGTGTACCTGCAGG + Intronic
1014714563 6:124849128-124849150 CTTAATTTCTGTGCACCCACAGG - Intergenic
1014721271 6:124920825-124920847 CTTGACTTCTGTGCACCCACAGG + Intergenic
1014883070 6:126746600-126746622 CTTGACTTCTGTGCACCCACAGG + Intergenic
1015351551 6:132225584-132225606 CTTGACTTCTGTGAACCCACAGG - Intergenic
1015808079 6:137132782-137132804 CTGGATTTCTGTGTTCCACGGGG - Intergenic
1015852988 6:137593654-137593676 CTTGACTTCTGTGCACCCACAGG + Intergenic
1016020743 6:139234571-139234593 CTTGACTTCTGTGCACCCACAGG - Intergenic
1016143644 6:140643931-140643953 CTTGACTTCTGTGCACCAGCAGG + Intergenic
1016176309 6:141081388-141081410 CTTGACTTCTGTGCACCCACAGG - Intergenic
1016219294 6:141646761-141646783 CTTGTTTTCTGTGCACCCACAGG - Intergenic
1016253212 6:142071913-142071935 CTTGACTTCTGTGCACCCACAGG - Intronic
1016281782 6:142426794-142426816 CTTGACTTCTGTGCACCCACAGG + Intronic
1016424160 6:143916251-143916273 CTTGACTTCTGTGCACCCACAGG - Intronic
1016470561 6:144370409-144370431 CTTGACTTCTGTGCACCTACAGG - Intronic
1016477363 6:144441829-144441851 CTTGACTTCTGTGTACCCGCAGG + Intronic
1017387982 6:153908016-153908038 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1017640668 6:156490780-156490802 CTTGACTTCTGTGCACCCACAGG - Intergenic
1018554572 6:165036408-165036430 CTTGACTTCTGTATGCTCACAGG - Intergenic
1018630626 6:165819070-165819092 CTTGAGTCCTGTGTGCCCACTGG + Intronic
1018894960 6:168007940-168007962 TTGGATTTCTGTGGGCCCACAGG + Intronic
1018922707 6:168186502-168186524 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1019868753 7:3737932-3737954 CTTGGTTTCTGTGGTCCAAGGGG + Intronic
1020171149 7:5846091-5846113 CTTTCATTCTGTGTACCAACTGG - Intergenic
1020631847 7:10649490-10649512 CTTGACTTCTGTGCACCCACAGG + Intergenic
1020755054 7:12191223-12191245 CTTGACTTCTGTGCACCCACAGG + Intergenic
1020958790 7:14776612-14776634 CTTGACTTCTGTGTACCCACAGG - Intronic
1022093563 7:27123901-27123923 CTTGCTTTCTGTGTCCCCAAAGG + Intronic
1022352296 7:29577602-29577624 CTTGACTTCTGTGAGCCTGCAGG - Intergenic
1022862511 7:34382877-34382899 CTTGATTTCTGTGCACCTGCAGG - Intergenic
1022964288 7:35458164-35458186 CTTGACTTCTGTGCACCCACAGG + Intergenic
1022969492 7:35504404-35504426 ATTGTTTTCTGAGTCCCAACAGG + Intergenic
1023543155 7:41288344-41288366 CTTGCATTCTGTGTGCCTACAGG - Intergenic
1023669358 7:42560135-42560157 CTTGACTTCTGTGTACCCACAGG - Intergenic
1024135061 7:46398380-46398402 CTTGAATTCTGTGGGGGAACTGG - Intergenic
1024487168 7:49931998-49932020 CTTGACCTCTGTGTACCCACAGG - Intronic
1024667266 7:51559378-51559400 CTTGACTTCTGTGCACCAGCAGG - Intergenic
1026292317 7:69018726-69018748 CTTGTATTCTATGTGCCCACAGG + Intergenic
1027279200 7:76593445-76593467 CTTGACTTCTGTGTACCAGAAGG + Intergenic
1027519092 7:79181345-79181367 CTTGACTTCTGTGCACCCACAGG + Intronic
1027681135 7:81223053-81223075 CTTGACTTCTGTGCACCTACTGG - Intergenic
1027704358 7:81510413-81510435 CTTGACTTCTGTGTACCCGCAGG - Intergenic
1027733925 7:81908190-81908212 CTTGACTTCTGTGCACCAATGGG + Intergenic
1027937833 7:84632288-84632310 CTTGATTTCTGTGCACCCATGGG - Intergenic
1027993556 7:85395297-85395319 CTTGACTTCTGTGTACCAGCAGG + Intergenic
1028032420 7:85932911-85932933 CTTGACTTCTATGTACCCACAGG - Intergenic
1028054184 7:86222831-86222853 CTTGACTTCTGTGCACCCACAGG + Intergenic
1028109236 7:86919154-86919176 CTTTATTTCTGTGGGGAAACAGG + Intronic
1028249702 7:88526317-88526339 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1028404870 7:90464359-90464381 CTTGATTTCTGTGCACCTACAGG - Intronic
1028493649 7:91441170-91441192 CTTGACTTCTGTGAACCCACAGG - Intergenic
1028624532 7:92863109-92863131 CTTGACTTCTGTGTACTCACAGG + Intergenic
1028708122 7:93874534-93874556 CTTGACTTCTTTGTGCCCACAGG - Intronic
1028961046 7:96750068-96750090 CTTGACTTCTGTGAACCCACAGG + Intergenic
1029948312 7:104556383-104556405 CTTGACTTCTGTGCACCCACAGG + Intronic
1029961455 7:104692668-104692690 CTTGACTTCTGTGTACCCGCAGG - Intronic
1030387732 7:108885962-108885984 CTTGATTTCTGGTTAACAACAGG - Intergenic
1030806822 7:113929701-113929723 ATTGACTTCTGTGTACCCACAGG - Intronic
1030826814 7:114168970-114168992 CTTGACTTCTGTGTACCAGCAGG - Intronic
1030851055 7:114487195-114487217 CTTGACTTCTGTGCCCCAACAGG + Intronic
1031172499 7:118309183-118309205 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1031298841 7:120039224-120039246 CTTGACTTCTGTGCACCAACAGG + Intergenic
1031522086 7:122778724-122778746 CTTGACTTCTGTGCACCCACAGG - Intronic
1031722452 7:125193723-125193745 CTTGTCTTCTGTGTACCAACAGG - Intergenic
1031783300 7:125997536-125997558 CTTGACTTCTGTGCACCCACAGG - Intergenic
1031791979 7:126118122-126118144 CTTGACTTCTGTGCACCCACAGG - Intergenic
1031874259 7:127120247-127120269 CTTCATTTCTGGTGGCCAACTGG - Intronic
1032560979 7:132892827-132892849 CTTGACTTCTGTGCGCCTGCAGG - Intronic
1032689929 7:134275423-134275445 CTTGATTTCTGTATTCCAGCAGG + Intergenic
1033419724 7:141194874-141194896 CTTGATGTCTGTGCACCCACAGG + Intronic
1033446392 7:141426002-141426024 CTTTATTGCTGTGTGTCATCTGG + Intronic
1033492021 7:141853448-141853470 CTTGACTTCTGTGCACCCACAGG + Intergenic
1033580312 7:142726728-142726750 CTTGACTTCTGTGCACCTACAGG + Intergenic
1033721092 7:144060231-144060253 CTTGACTTCTGTGCACCCACAGG - Intergenic
1033833062 7:145276475-145276497 CTTGACTTCTGTGCACCTACAGG - Intergenic
1033885035 7:145934099-145934121 CTTGACTTCTCTGTACCCACAGG - Intergenic
1034020146 7:147633252-147633274 TTTGACTTCTGTGTACCCACAGG - Intronic
1034094477 7:148394314-148394336 CTTCATTTCTGAGTCCCTACTGG + Intronic
1034209295 7:149349001-149349023 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1034742909 7:153495160-153495182 CTTGAATTCTGTGCACCCACAGG - Intergenic
1034751054 7:153569353-153569375 CTTGACTTCTGTGAACCCACAGG + Intergenic
1034751321 7:153571526-153571548 CTTGACTTCTGTGCCCCCACAGG - Intergenic
1034751878 7:153576464-153576486 CTTGACTTCTGTGTACTCACAGG - Intergenic
1034851904 7:154501594-154501616 CTTGACTTCTGTGCACCCACAGG - Intronic
1035468965 7:159097747-159097769 CTTGGTCTGTGTGTCCCAACTGG - Intronic
1036143131 8:6226317-6226339 CTTCATCTCTCTGTGCCTACAGG + Intergenic
1036457711 8:8924339-8924361 CTTGACTTCTGTCCACCAACAGG + Intergenic
1037213934 8:16425929-16425951 CTTGATTTCTGTGTGCACTCAGG - Intronic
1037948858 8:23006022-23006044 CTTGATTTCTGGGTACCACATGG - Exonic
1038298963 8:26324447-26324469 CTTGACTTCTGTGCACCCACAGG - Intronic
1039082332 8:33745373-33745395 CTTGACTTCTGTGCACCCACAGG + Intergenic
1039298232 8:36181309-36181331 CTTGACTTCTGTGCATCAACAGG + Intergenic
1039652135 8:39353534-39353556 CTTGACTTCTGTGTGCCCACAGG - Intergenic
1040721453 8:50329460-50329482 CTTGACTTCTGTGTACCTGCAGG + Intronic
1040813408 8:51481794-51481816 CTTGACTTCTGTGTACCCACAGG - Intronic
1041632083 8:60099642-60099664 CTTGCTTTCTGTGCACCCACAGG + Intergenic
1041849858 8:62378674-62378696 CTTGTCTTCTGTGTACCCACAGG - Intronic
1041927554 8:63252216-63252238 CTTGACTTCTGTGAACCCACAGG - Intergenic
1042057989 8:64786886-64786908 CTTGACTTCTGTGCACCCACAGG + Intronic
1042073934 8:64967661-64967683 CTTGACTTCTGTGCACCCACAGG + Intergenic
1042169768 8:65980156-65980178 CTTGACTTCTGTGCACCTACAGG - Intergenic
1042701122 8:71616074-71616096 CTTAAGTTCTGTGAGCCAAGAGG + Intergenic
1042772954 8:72398916-72398938 CTTGACTTCTGTGTACCCACAGG + Intergenic
1042953599 8:74225476-74225498 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1043308210 8:78823496-78823518 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1043510510 8:80946065-80946087 CTTGACTTCTGTGTACCCACAGG - Intergenic
1043749875 8:83921966-83921988 CTTGACTTCTGTGCACCCACAGG + Intergenic
1044066572 8:87706304-87706326 CTTGACTTCTGAGTACCCACAGG + Intergenic
1044125303 8:88452250-88452272 CTTGACTTCTGTGCACCTACAGG + Intergenic
1044188436 8:89283892-89283914 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1044220437 8:89663468-89663490 GTTGATTTCTGAGTACCCACCGG + Intergenic
1044279722 8:90341021-90341043 CTTGACTTCTGTGCACCCACAGG - Intergenic
1044784700 8:95781676-95781698 CTTGATTTCTGTGCACCCGCAGG - Intergenic
1045053612 8:98349695-98349717 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1045214173 8:100130224-100130246 CTTGACTTCTGTGCACCCACAGG + Intronic
1045437007 8:102173668-102173690 CTTGCACTCTGTGTGCCTACAGG + Intergenic
1045588178 8:103562857-103562879 CTTGATTTCTGTGCACCCGCAGG + Intronic
1045904747 8:107331601-107331623 CTTGATTTCTGTGAGCCTCAGGG + Intronic
1045940075 8:107728540-107728562 CTTGACTTCTGTGCACCCACAGG + Intergenic
1046052895 8:109044700-109044722 CTTGACTTCTGTGCACCTACAGG + Intergenic
1046231523 8:111364546-111364568 CTTGACTTCTGTGAACCCACAGG + Intergenic
1046309447 8:112415359-112415381 CTTGACTTCTGTGCACCCACAGG - Intronic
1046311241 8:112440684-112440706 CTTGATTTTTGTGTACCCACAGG + Intronic
1046358358 8:113117359-113117381 CTTGACTTCTGTGTACCCTCAGG - Intronic
1046405701 8:113769711-113769733 CTTGACTTCTGTGTACCCAGAGG - Intergenic
1046433133 8:114153876-114153898 CTTTATTTCTGTGCACCCACAGG + Intergenic
1046786480 8:118272187-118272209 CTTGATCTCTGTGTACCCACAGG + Intronic
1047060462 8:121219374-121219396 CTTGACATCTGTGTACCCACAGG + Intergenic
1047115954 8:121842259-121842281 CTTGACTTCTGTGCACCCACAGG - Intergenic
1047869946 8:129071506-129071528 CTTGACTTCTGTGTACCCACAGG - Intergenic
1048137408 8:131759739-131759761 CTTGATTTCTGTGCACCCACAGG - Intergenic
1048189259 8:132273271-132273293 CTTGACTTCTGTGCACCCACAGG + Intronic
1048669083 8:136696056-136696078 CTTGACTTCTGTGCACCCACAGG - Intergenic
1048746037 8:137615869-137615891 CTTGACTTCTGTGCACCAGCAGG + Intergenic
1048772779 8:137912996-137913018 CTTGACTTCTGTGCACCCACAGG + Intergenic
1049903156 9:189514-189536 CTTGACTTCTGTGCACCCACAGG + Intergenic
1050079796 9:1904313-1904335 CTTGACTTCTGTGTACCCACAGG - Intergenic
1050264052 9:3871537-3871559 CTTGACTTCTGTGTACCCGCAGG + Intronic
1050412506 9:5381462-5381484 CTTGACTTCTGTGCACCCACAGG - Intronic
1050464928 9:5912179-5912201 TATCATTTCTGTATGCCAACAGG - Intronic
1050915224 9:11122680-11122702 CTTAACTTCTGTGTACCTACAGG + Intergenic
1051048573 9:12904848-12904870 ATTGATTTCTGAGTGTCAATAGG + Intergenic
1051128714 9:13835200-13835222 CTTGACTTCTGTGCACCCACAGG - Intergenic
1051984251 9:23063696-23063718 CTTGACTTCTGTGCACCCACAGG + Intergenic
1052070972 9:24081047-24081069 CTTGACTTCTGTGCACCCACAGG - Intergenic
1052105543 9:24510300-24510322 CTTGACTTCTGTGCACCCACAGG - Intergenic
1052168835 9:25368340-25368362 CTTTATTTCTGTATGCCATTAGG + Intergenic
1052351772 9:27465724-27465746 CTTGACTTCTGTGCACCCACAGG + Intronic
1052518191 9:29510306-29510328 CTTGACTTCTGTGCACCCACAGG + Intergenic
1052557136 9:30032149-30032171 CTTGACTTCTGTGCACCCACAGG + Intergenic
1052599065 9:30600468-30600490 CTTGACTTCTGTGTACCCACAGG + Intergenic
1053371337 9:37564197-37564219 CTTGACTTCTGTGCACCCACAGG - Intronic
1053571945 9:39318813-39318835 CTTGACTTCTGTGAACCCACAGG - Intergenic
1053574507 9:39345105-39345127 CTTGACTTCTGTGCACCCACAGG - Intergenic
1053641668 9:40088261-40088283 CTTGATTTCTGTGCATCCACAGG + Intergenic
1053764468 9:41377203-41377225 CTTGATTTCTGTGCATCCACAGG - Intergenic
1053882660 9:42611533-42611555 CTTGACTTCTGTGAACCCACAGG + Intergenic
1053890009 9:42682769-42682791 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054093499 9:60877524-60877546 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054096071 9:60903795-60903817 CTTGACTTCTGTGCACCCACAGG - Intergenic
1054114982 9:61153444-61153466 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054117534 9:61179734-61179756 CTTGACTTCTGTGCACCCACAGG - Intergenic
1054125200 9:61300198-61300220 CTTGACTTCTGTGAACCCACAGG + Intergenic
1054221687 9:62419001-62419023 CTTGACTTCTGTGAACCCACAGG + Intergenic
1054229027 9:62490172-62490194 CTTGACTTCTGTGAACCCACAGG - Intergenic
1054322558 9:63685650-63685672 CTTGATTTCTGTGCATCCACAGG + Intergenic
1054344993 9:63905689-63905711 CTTGACTTCTGTGCACCCACAGG - Intergenic
1054543083 9:66288380-66288402 CTTGATTTCTGTGCATCCACAGG - Intergenic
1054590221 9:67002832-67002854 CTTGACTTCTGTGCACCCACAGG + Intergenic
1054592774 9:67029090-67029112 CTTGACTTCTGTGAACCCACAGG + Intergenic
1055264116 9:74475894-74475916 CTTGATTTCTGTGCACTCACAGG - Intergenic
1055566352 9:77572744-77572766 CTTGGTGTCTGTGTGCCTCCTGG + Intronic
1055713335 9:79089058-79089080 CTTGACTTCTGTGCACCCACAGG + Intergenic
1055878471 9:80970737-80970759 CTTGAATTCTGTGTACCCCCAGG - Intergenic
1056042844 9:82685864-82685886 CTTGACTTCTGTGCACCCACAGG + Intergenic
1056087052 9:83160935-83160957 CTTGACTTCTGTGCACCTACAGG - Intergenic
1056283934 9:85069425-85069447 CTTGACTTCTGTGCACCCACAGG - Intergenic
1056639390 9:88357667-88357689 CTTGACTTCTGTGCACCCACAGG - Intergenic
1056742988 9:89276054-89276076 CTTGACTTCTGTGCACCCACAGG + Intergenic
1056915065 9:90739122-90739144 CTTGACTTCTGTGTACCCACAGG + Intergenic
1058076527 9:100657222-100657244 CTTGATTTCTGTGTACCCACAGG - Intergenic
1058082241 9:100712526-100712548 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1058174529 9:101722235-101722257 CTTGACTTCAGTGTACCCACAGG - Intronic
1058223007 9:102325893-102325915 CTTGACTTCTGTGTACCTGCAGG - Intergenic
1058292228 9:103256935-103256957 CTTGACTTCTGTGCACCCACAGG + Intergenic
1058330756 9:103757023-103757045 CTTGTCTTCTGTGTACCCACAGG + Intergenic
1058472525 9:105295599-105295621 CTTGCTTTCCCTGTACCAACAGG + Intronic
1058663882 9:107291378-107291400 CTTAATTTCTGTGGGACAAATGG + Intronic
1058834457 9:108848761-108848783 CTTGACTTCTGTGCACCCACAGG + Intergenic
1059069501 9:111120519-111120541 CTTGACTTCTGTGCACCCACAGG + Intergenic
1059587253 9:115619709-115619731 CTTGACTTCTGTGCACCCACAGG + Intergenic
1059601415 9:115783313-115783335 CTTGACTTCTGTGTACCCACAGG - Intergenic
1059843327 9:118243023-118243045 CTTGACTTCTCTGTACCTACAGG + Intergenic
1060178365 9:121514330-121514352 CTTGACTTCTGTGCACCCACAGG + Intergenic
1060311941 9:122470370-122470392 CTTGACTTCTGTGCACCCACAGG - Intergenic
1060653626 9:125352395-125352417 CTTGACTTCTGTGCACCCACAGG + Intronic
1061651677 9:132055216-132055238 CTTCATTTCTGTCAGCAAACAGG + Intronic
1061660672 9:132128169-132128191 CTGGATCTCTGACTGCCAACTGG + Intergenic
1062639792 9:137513024-137513046 CTTGCTTTTTTTGTGCCATCGGG - Intronic
1202789446 9_KI270719v1_random:71347-71369 CTTGATTTCTGTGCATCCACAGG + Intergenic
1186053314 X:5623653-5623675 CTTGACTTCTGTGCACCCACAGG - Intergenic
1186620441 X:11235205-11235227 CTTGACTTCTGTGTACCCACGGG + Intronic
1186679317 X:11855068-11855090 CTTGATTTCTGTGCACCCACAGG + Intergenic
1186704623 X:12128283-12128305 TTTGACTTCTGTGTACCCACAGG + Intergenic
1186980778 X:14955294-14955316 CTTGACTTCTGTGTGCTGGCAGG + Intergenic
1187574758 X:20542464-20542486 CTTGACTTCTGTGTACCCACAGG - Intergenic
1187639658 X:21274191-21274213 CTTGCCTTCTGTGTGCCCAAAGG + Intergenic
1187667397 X:21628557-21628579 CTTGACTTCTGTGCACCCACAGG + Intronic
1187796200 X:23006658-23006680 CTTGACTTCTGTGCACCCACAGG + Intergenic
1188056045 X:25542108-25542130 CTTGACTTCTGTGCACCCACAGG + Intergenic
1188114990 X:26231947-26231969 CTTGACTTCTATGTGCCTGCAGG + Intergenic
1188158915 X:26776422-26776444 CTTGACTTCTGTGCACCCACAGG - Intergenic
1188305767 X:28558460-28558482 CTTGACTTCTGTGTACCCCCAGG + Intergenic
1188624329 X:32265319-32265341 CTTGACTTCTGTGTACCCACAGG - Intronic
1188719490 X:33505588-33505610 CTTGACTTCTGTGCACCCACAGG - Intergenic
1188731176 X:33648025-33648047 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1188773962 X:34189719-34189741 ATTGACTTCTGTGTACCCACAGG + Intergenic
1188997603 X:36904906-36904928 CTTGACTTCTGTGCACCCACAGG - Intergenic
1189669754 X:43395263-43395285 CTTGACTTCTGTGTCCCCGCAGG + Intergenic
1189788710 X:44583323-44583345 CTTGACTTCTGTGGACCCACAGG - Intergenic
1189896152 X:45658739-45658761 CTTGACTTCTGTGCACCCACAGG - Intergenic
1191052297 X:56206947-56206969 CTTGATTTCTGTGCACCCACCGG + Intergenic
1191674260 X:63778195-63778217 CTTGACTTCTGTGTACCCGCAGG + Intronic
1192131891 X:68559409-68559431 CTTGACTTCTGTGTACCCACAGG + Intergenic
1192335620 X:70216966-70216988 CTTGACTTCTGTGTACCCACAGG - Intergenic
1192378306 X:70587508-70587530 CTTGACTTCTGTGCACCCACAGG - Intronic
1192742433 X:73906116-73906138 CTTGACTTCTGTGCACCCACAGG - Intergenic
1193025164 X:76839017-76839039 CTTGATTTCTGTGCAACCACAGG + Intergenic
1193066386 X:77264856-77264878 CTTGCCTTCTGTGTACCCACAGG - Intergenic
1193198967 X:78665730-78665752 CTTGACTTCTGTGTATCCACAGG - Intergenic
1193271510 X:79534754-79534776 CTTGCATTCTGTGTGCCTGCAGG + Intergenic
1193271779 X:79537370-79537392 CTTGACTTCTGTGTACTCACAGG - Intergenic
1193307960 X:79972219-79972241 CTTGACTTCTGTGTACTTACAGG - Intergenic
1193320398 X:80114880-80114902 CTTGACTTCTGTGCACCCACAGG - Intergenic
1193459730 X:81775912-81775934 CTTGACTTCTGTGCACCCACAGG + Intergenic
1193460542 X:81786541-81786563 CTTGACTTCTGTGTACCCAGAGG + Intergenic
1193503556 X:82310228-82310250 CTTGACTTCTGTGTACCCGCAGG + Intergenic
1193686228 X:84580154-84580176 CTTGACTTCTGTGCACCCACAGG - Intergenic
1193759179 X:85443267-85443289 CTTGACTTCTGTGCACCCACAGG + Intergenic
1193948195 X:87764289-87764311 CTTGCCTTCTGTGTACCCACAGG + Intergenic
1194024944 X:88739578-88739600 CTTGCATTCTCTGTGCCTACAGG + Intergenic
1194082556 X:89486704-89486726 CTTGACTCCTGTGTACCCACAGG + Intergenic
1194145317 X:90254887-90254909 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1194224324 X:91236896-91236918 CTTTATTTCTGTGTGTTTACTGG - Intergenic
1194256915 X:91646144-91646166 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194332474 X:92600494-92600516 CTTGACTTCTGTGCACCCACAGG - Intronic
1194503815 X:94708597-94708619 CTTGACTTCTGTGCACCCACAGG + Intergenic
1194505608 X:94730088-94730110 CTTGACTTCTGTGCACCCACAGG + Intergenic
1194507067 X:94745919-94745941 CTTGATTTCTGTGCACCTGCAGG - Intergenic
1194517276 X:94870962-94870984 CTTGATTTCTTTTAGCCAAAGGG + Intergenic
1194582821 X:95697534-95697556 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194756305 X:97743340-97743362 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194830776 X:98620050-98620072 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1194843613 X:98776068-98776090 CTTGACTTCTGTGCACCCACAGG - Intergenic
1194903402 X:99543075-99543097 CTTGCTTTCTGTGCACCCACAGG - Intergenic
1195206936 X:102610801-102610823 CTTGACTTCTGTGCACCCACAGG - Intergenic
1195484346 X:105386370-105386392 CTGGATTTCTGTGTGCTACGAGG + Intronic
1195525921 X:105889656-105889678 CTTGATTTCTGTGCATCAGCAGG + Intronic
1196012628 X:110904792-110904814 CTTGACTTCTGTGCACCCACAGG + Intergenic
1196169784 X:112574821-112574843 CTTGACTTCTGTGCACCCACAGG - Intergenic
1196285195 X:113871590-113871612 CTTAATTTCTGTGCACCCACAGG - Intergenic
1196503335 X:116411243-116411265 ATTGATTTCTGTGCTCCAGCAGG - Intergenic
1196565210 X:117196861-117196883 CTTGACTACTGTGTACCCACAGG - Intergenic
1196747714 X:119086506-119086528 CTTGATATCTGCTTGCCATCTGG + Intronic
1197040763 X:121932675-121932697 CTTGACTTCTGTGTACCAGCAGG + Intergenic
1197054277 X:122097950-122097972 CTTGACTTCTGTGTACCCACGGG - Intergenic
1197349791 X:125369919-125369941 CTTGACTTCTGTGCACCCACAGG + Intergenic
1197383056 X:125769207-125769229 CTTGATTACTGTGCTCCAAAGGG - Intergenic
1197400099 X:125979462-125979484 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1197431883 X:126376818-126376840 CTTGACTTCTGTGCACCCACAGG + Intergenic
1197485057 X:127038683-127038705 TTTGTTTTTTGTTTGCCAACAGG - Intergenic
1197511121 X:127370879-127370901 CTTTATTTCTGTGTACCCATAGG + Intergenic
1197527031 X:127576337-127576359 CTTGACTTCTGTGCACCCACAGG + Intergenic
1197639754 X:128954709-128954731 CTTGACTTCTGTGCACCCACAGG + Intergenic
1198483077 X:137058792-137058814 CTTGATTTCAGTTTACTAACTGG - Intergenic
1198497159 X:137204235-137204257 CTTGACTTCTGTGCACCCACAGG + Intergenic
1198566065 X:137906738-137906760 CTTGACTTCTGTGCACCCACAGG - Intergenic
1198919365 X:141708356-141708378 CTTGACTTCTGTGCACCCACAGG + Intergenic
1198941981 X:141966058-141966080 CTTGACTTCTGTGTACCCACAGG - Intergenic
1198951696 X:142079612-142079634 CTTGACTTCTGTGTACTCACAGG + Intergenic
1199042230 X:143127346-143127368 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199043224 X:143139102-143139124 CTTGACTTCTGTGCACCCACTGG - Intergenic
1199134463 X:144234365-144234387 CTTGCACTCTGTGTGCCTACAGG - Intergenic
1199147061 X:144380785-144380807 TTTGACTTCTGTGTACCCACAGG - Intergenic
1199155029 X:144536881-144536903 CTTGACTTCTGTGCACCCACAGG + Intergenic
1199185478 X:144910684-144910706 CTTGACTTCTGTGTACCTGCAGG + Intergenic
1199220330 X:145309587-145309609 CTTGACTTCTGTGCTCCTACAGG + Intergenic
1199228674 X:145409608-145409630 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199289914 X:146093872-146093894 CTTGTGTTCTGTATGCCCACAGG + Intergenic
1199291114 X:146105897-146105919 CTTGACTTCTGTGTACCCACAGG + Intergenic
1199349826 X:146787659-146787681 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199357172 X:146875789-146875811 CTTGATTTCTGTGCACCCACAGG - Intergenic
1199389411 X:147262192-147262214 CTTGACTTCTGTGAACCCACAGG - Intergenic
1199420345 X:147637164-147637186 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199560664 X:149159526-149159548 CTTGACTTCTGTGCACCAGCAGG + Intergenic
1199566084 X:149217142-149217164 CTTGACTTCTGTATACCCACAGG - Intergenic
1199869785 X:151888105-151888127 CTTGACTTCTGTGCACCCACAGG - Intergenic
1199908761 X:152261994-152262016 CTTGACTTCTGTGTACCTGCAGG + Intronic
1200435204 Y:3142585-3142607 CTTGACTCCTGTGTACCCACAGG + Intergenic
1200491079 Y:3824185-3824207 CTTGATTTCTGTGCACCTGCAGG + Intergenic
1200560786 Y:4700259-4700281 CTTTATTTCTGTGTGTTTACTGG - Intergenic
1200575634 Y:4885411-4885433 CTTGACTTCTGTGCACCCACAGG - Intergenic
1200641175 Y:5719546-5719568 CTTGACTTCTGTGCACCCACAGG - Intronic
1200868955 Y:8076510-8076532 CTTGCCTTCTGTGTGTCCACAGG - Intergenic
1200898003 Y:8396464-8396486 CCTGCTTTCTGTATGCCCACAGG - Intergenic
1201452250 Y:14129173-14129195 CTTGACTTCTGTGCACCCACAGG - Intergenic