ID: 978991246

View in Genome Browser
Species Human (GRCh38)
Location 4:115084747-115084769
Sequence AACCTCCGCCTATAATTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3158
Summary {0: 1, 1: 1, 2: 140, 3: 1315, 4: 1701}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978991245_978991246 14 Left 978991245 4:115084710-115084732 CCTGTTGGCACACAGAAATCAAG 0: 1
1: 0
2: 14
3: 166
4: 986
Right 978991246 4:115084747-115084769 AACCTCCGCCTATAATTCAGAGG 0: 1
1: 1
2: 140
3: 1315
4: 1701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978991246 Original CRISPR AACCTCCGCCTATAATTCAG AGG Intronic
Too many off-targets to display for this crispr