ID: 978995087

View in Genome Browser
Species Human (GRCh38)
Location 4:115140768-115140790
Sequence TTCAGAAATGCGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978995087_978995093 2 Left 978995087 4:115140768-115140790 CCTTCCACCTCCGCATTTCTGAA No data
Right 978995093 4:115140793-115140815 GAAGCTTGTTACTGACTGAAGGG No data
978995087_978995092 1 Left 978995087 4:115140768-115140790 CCTTCCACCTCCGCATTTCTGAA No data
Right 978995092 4:115140792-115140814 GGAAGCTTGTTACTGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978995087 Original CRISPR TTCAGAAATGCGGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr