ID: 978996422

View in Genome Browser
Species Human (GRCh38)
Location 4:115160383-115160405
Sequence ATACTATTCCTGAAGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978996422_978996425 16 Left 978996422 4:115160383-115160405 CCACTTTCCTTCAGGAATAGTAT No data
Right 978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978996422 Original CRISPR ATACTATTCCTGAAGGAAAG TGG (reversed) Intergenic
No off target data available for this crispr