ID: 978996423

View in Genome Browser
Species Human (GRCh38)
Location 4:115160390-115160412
Sequence ATTAGTGATACTATTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978996423_978996425 9 Left 978996423 4:115160390-115160412 CCTTCAGGAATAGTATCACTAAT No data
Right 978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978996423 Original CRISPR ATTAGTGATACTATTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr