ID: 978996425

View in Genome Browser
Species Human (GRCh38)
Location 4:115160422-115160444
Sequence TATCCCAATATAATTTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978996423_978996425 9 Left 978996423 4:115160390-115160412 CCTTCAGGAATAGTATCACTAAT No data
Right 978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG No data
978996422_978996425 16 Left 978996422 4:115160383-115160405 CCACTTTCCTTCAGGAATAGTAT No data
Right 978996425 4:115160422-115160444 TATCCCAATATAATTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978996425 Original CRISPR TATCCCAATATAATTTGTGC TGG Intergenic
No off target data available for this crispr