ID: 979010160

View in Genome Browser
Species Human (GRCh38)
Location 4:115356362-115356384
Sequence CCCTGGACAGGAATGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979010160_979010165 9 Left 979010160 4:115356362-115356384 CCTCCGGGCATTCCTGTCCAGGG No data
Right 979010165 4:115356394-115356416 TATTCATAAGATGACTAATGTGG No data
979010160_979010167 18 Left 979010160 4:115356362-115356384 CCTCCGGGCATTCCTGTCCAGGG No data
Right 979010167 4:115356403-115356425 GATGACTAATGTGGAGGCATTGG No data
979010160_979010166 12 Left 979010160 4:115356362-115356384 CCTCCGGGCATTCCTGTCCAGGG No data
Right 979010166 4:115356397-115356419 TCATAAGATGACTAATGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979010160 Original CRISPR CCCTGGACAGGAATGCCCGG AGG (reversed) Intergenic
No off target data available for this crispr