ID: 979011043

View in Genome Browser
Species Human (GRCh38)
Location 4:115368845-115368867
Sequence TTCCCAAGGCTGCTTTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979011038_979011043 29 Left 979011038 4:115368793-115368815 CCCAGAATTGCTTCTATCAAGAA No data
Right 979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG No data
979011039_979011043 28 Left 979011039 4:115368794-115368816 CCAGAATTGCTTCTATCAAGAAT No data
Right 979011043 4:115368845-115368867 TTCCCAAGGCTGCTTTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979011043 Original CRISPR TTCCCAAGGCTGCTTTATAC TGG Intergenic
No off target data available for this crispr