ID: 979011098

View in Genome Browser
Species Human (GRCh38)
Location 4:115369955-115369977
Sequence TACTGTGTGCAGTAAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979011096_979011098 2 Left 979011096 4:115369930-115369952 CCAGCCTCTTTGAACTTAAAAAA No data
Right 979011098 4:115369955-115369977 TACTGTGTGCAGTAAAATACTGG No data
979011097_979011098 -2 Left 979011097 4:115369934-115369956 CCTCTTTGAACTTAAAAAATCTA No data
Right 979011098 4:115369955-115369977 TACTGTGTGCAGTAAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979011098 Original CRISPR TACTGTGTGCAGTAAAATAC TGG Intergenic
No off target data available for this crispr