ID: 979012055

View in Genome Browser
Species Human (GRCh38)
Location 4:115384613-115384635
Sequence CTGGTTAGGTTGCAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979012055_979012059 8 Left 979012055 4:115384613-115384635 CCTTTTTTCTGCAACCTAACCAG No data
Right 979012059 4:115384644-115384666 ATTTTTTGACTCTTTAATAATGG No data
979012055_979012060 27 Left 979012055 4:115384613-115384635 CCTTTTTTCTGCAACCTAACCAG No data
Right 979012060 4:115384663-115384685 ATGGCCATTCTGTTATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979012055 Original CRISPR CTGGTTAGGTTGCAGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr