ID: 979012684

View in Genome Browser
Species Human (GRCh38)
Location 4:115391359-115391381
Sequence TTGAATAGGAATGATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979012684_979012691 11 Left 979012684 4:115391359-115391381 CCTCCCTCATCATTCCTATTCAA No data
Right 979012691 4:115391393-115391415 AAGTTCTGGCCAGGGCAATCAGG 0: 6624
1: 7821
2: 3183
3: 2190
4: 2951
979012684_979012690 3 Left 979012684 4:115391359-115391381 CCTCCCTCATCATTCCTATTCAA No data
Right 979012690 4:115391385-115391407 AGTATTGAAAGTTCTGGCCAGGG 0: 96
1: 2210
2: 10920
3: 3704
4: 1394
979012684_979012689 2 Left 979012684 4:115391359-115391381 CCTCCCTCATCATTCCTATTCAA No data
Right 979012689 4:115391384-115391406 TAGTATTGAAAGTTCTGGCCAGG 0: 83
1: 2079
2: 10816
3: 4087
4: 1630
979012684_979012688 -3 Left 979012684 4:115391359-115391381 CCTCCCTCATCATTCCTATTCAA No data
Right 979012688 4:115391379-115391401 CAACATAGTATTGAAAGTTCTGG 0: 86
1: 2188
2: 11099
3: 4291
4: 1753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979012684 Original CRISPR TTGAATAGGAATGATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr