ID: 979017332

View in Genome Browser
Species Human (GRCh38)
Location 4:115451285-115451307
Sequence CAGGGAGAATGTAATCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979017332_979017335 12 Left 979017332 4:115451285-115451307 CCAACTTGATTACATTCTCCCTG No data
Right 979017335 4:115451320-115451342 ACACCAATCAAATGTAGATTTGG 0: 324
1: 1670
2: 4191
3: 2462
4: 1296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979017332 Original CRISPR CAGGGAGAATGTAATCAAGT TGG (reversed) Intergenic
No off target data available for this crispr