ID: 979017335

View in Genome Browser
Species Human (GRCh38)
Location 4:115451320-115451342
Sequence ACACCAATCAAATGTAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9943
Summary {0: 324, 1: 1670, 2: 4191, 3: 2462, 4: 1296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979017333_979017335 -6 Left 979017333 4:115451303-115451325 CCCTGTCACTTTCATGTACACCA No data
Right 979017335 4:115451320-115451342 ACACCAATCAAATGTAGATTTGG 0: 324
1: 1670
2: 4191
3: 2462
4: 1296
979017331_979017335 27 Left 979017331 4:115451270-115451292 CCTGAAGAGTGTTTTCCAACTTG 0: 1181
1: 6168
2: 2387
3: 878
4: 781
Right 979017335 4:115451320-115451342 ACACCAATCAAATGTAGATTTGG 0: 324
1: 1670
2: 4191
3: 2462
4: 1296
979017332_979017335 12 Left 979017332 4:115451285-115451307 CCAACTTGATTACATTCTCCCTG No data
Right 979017335 4:115451320-115451342 ACACCAATCAAATGTAGATTTGG 0: 324
1: 1670
2: 4191
3: 2462
4: 1296
979017334_979017335 -7 Left 979017334 4:115451304-115451326 CCTGTCACTTTCATGTACACCAA 0: 28
1: 2914
2: 4003
3: 1794
4: 963
Right 979017335 4:115451320-115451342 ACACCAATCAAATGTAGATTTGG 0: 324
1: 1670
2: 4191
3: 2462
4: 1296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979017335 Original CRISPR ACACCAATCAAATGTAGATT TGG Intergenic
Too many off-targets to display for this crispr