ID: 979024745

View in Genome Browser
Species Human (GRCh38)
Location 4:115554962-115554984
Sequence GAAAGCACAAAGGTGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979024745_979024750 30 Left 979024745 4:115554962-115554984 CCTAACTCCACCTTTGTGCTTTC No data
Right 979024750 4:115555015-115555037 ATACTTTTAAAATGTATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979024745 Original CRISPR GAAAGCACAAAGGTGGAGTT AGG (reversed) Intergenic
No off target data available for this crispr