ID: 979027153

View in Genome Browser
Species Human (GRCh38)
Location 4:115592159-115592181
Sequence CTTTGCATCCACAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979027149_979027153 14 Left 979027149 4:115592122-115592144 CCTTATTGTTCTATTCAGTCTCT No data
Right 979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG No data
979027148_979027153 20 Left 979027148 4:115592116-115592138 CCTCTACCTTATTGTTCTATTCA No data
Right 979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG No data
979027147_979027153 24 Left 979027147 4:115592112-115592134 CCTTCCTCTACCTTATTGTTCTA No data
Right 979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979027153 Original CRISPR CTTTGCATCCACAAGGAGGA GGG Intergenic
No off target data available for this crispr