ID: 979027928

View in Genome Browser
Species Human (GRCh38)
Location 4:115600469-115600491
Sequence CTGTGGCTACTTAGGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979027924_979027928 21 Left 979027924 4:115600425-115600447 CCAAGGAAAACACATTATTGGAA No data
Right 979027928 4:115600469-115600491 CTGTGGCTACTTAGGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979027928 Original CRISPR CTGTGGCTACTTAGGAAAAG TGG Intergenic
No off target data available for this crispr