ID: 979029148

View in Genome Browser
Species Human (GRCh38)
Location 4:115618375-115618397
Sequence CTGAGTAGAAGCAGCACGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979029148_979029156 -4 Left 979029148 4:115618375-115618397 CCATCCGTGCTGCTTCTACTCAG No data
Right 979029156 4:115618394-115618416 TCAGGGTGGAAGGTAGGCAAGGG No data
979029148_979029158 18 Left 979029148 4:115618375-115618397 CCATCCGTGCTGCTTCTACTCAG No data
Right 979029158 4:115618416-115618438 GATCTGGTCATCAGTGTGTGTGG No data
979029148_979029155 -5 Left 979029148 4:115618375-115618397 CCATCCGTGCTGCTTCTACTCAG No data
Right 979029155 4:115618393-115618415 CTCAGGGTGGAAGGTAGGCAAGG No data
979029148_979029159 29 Left 979029148 4:115618375-115618397 CCATCCGTGCTGCTTCTACTCAG No data
Right 979029159 4:115618427-115618449 CAGTGTGTGTGGAGATCACATGG No data
979029148_979029154 -10 Left 979029148 4:115618375-115618397 CCATCCGTGCTGCTTCTACTCAG No data
Right 979029154 4:115618388-115618410 TTCTACTCAGGGTGGAAGGTAGG No data
979029148_979029157 2 Left 979029148 4:115618375-115618397 CCATCCGTGCTGCTTCTACTCAG No data
Right 979029157 4:115618400-115618422 TGGAAGGTAGGCAAGGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979029148 Original CRISPR CTGAGTAGAAGCAGCACGGA TGG (reversed) Intergenic
No off target data available for this crispr